Cynodon dactylon

From ICG
Jump to: navigation, search

Description

Cynodon dactylon.png
  • Cynodon dactylon, a perennial grass species, is an important turfgrass widely used in public parks, home lawns, golf courses and sports fields. In addition to turfgrass, it is also used as forage settings. It is abundant in China and widely distributed in tropical, subtropical and warm-temperate regions. It exhibits a wide range of genetic variability in stress tolerance, having superior drought and heat tolerance, but relatively poor salinity and cold tolerance[1] [2].
  • Common Name: Vilfa stellata, Dūrvā grass, Dhoob, Bermuda grass, Dubo, Dog's tooth grass, Bahama grass, Devil's grass, Couch grass
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] Protein phosphatase 2A
  • Roots and leaves under salt stress
  • Leaves under drought & heat stress
  • Roots exposed to cold and heat stress
ES306101
  • F:ACTACTTCCCCTTGACGGC
  • R:AAATACCCCAACCACATCG
183 60 TaqMan
CACS[1] Clathrin adaptor complex subunit
  • Roots and leaves under salt stress
  • Leaves under drought stress
  • Roots exposed to cold & heat stress
ES306283
  • F:TCCTGAAGGTTTGGGAGAAG
  • R:AAATAACAGTTCCGAAGAGCC
129 60 TaqMan
EF1α[1] Elongation factor 1a
  • Roots under drought stress
ES296122
  • F:TGTCCCTGTCGGTCGTGTT
  • R:AGCCTCATGGTGCATCTCA
112 60 TaqMan
TIP41[1] TIP41-like family protein
  • Leaves under heat stress
  • Roots under drought stress
ES303032
  • F:AATTGACCTTGTCGCTCTTTC
  • R:GTCGGCATTACCCTCACTCT
126 60 TaqMan
UPL7[1] E3 ubiquitin-protein ligase
  • Leaves under cold stress
ES295712
  • F:CTACGGCAGCACAAACCATC
  • R:TGTACAAACTCCCCGAAAGG
188 60 TaqMan
TUB[1] Alpha tubulin
  • Leaves under cold stress
ES302563
  • F:AAGGACTACGAGGAGGTCGG
  • R:ACTGGATAGCAGCGGCACA
120 60 TaqMan
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Leaves under cold stress
ES302571
  • F:CCCTTCATCACCACCGACTA
  • R:GAATCTCCTCTGGGTTCCTG
157 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Martin Filion
  • Email: martin.filion@umoncton.ca
  • Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9, Canada

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Chen Y, Tan Z, Hu B, et al. (2014) Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol Plant.
  2. Zheng Y, Xu S, Liu J, Zhao Y, Liu J (2017) Genetic diversity and population structure of Chinese natural bermudagrass [Cynodon dactylon (L.) Pers.] germplasm based on SRAP markers. PLoS One 12, e0177508.

Categories