Danaus plexippus

From ICG
Jump to: navigation, search

Description

Danaus plexippus.png
  • Danaus plexippus is famous for its late summer/autumn southward migration from the United States and southern Canada to Mexico, and northward return in spring, which occurs over the lifespan of three to four generations of the butterfly. D. plexippus has drawn attention as a surrogate species for the ecological risk assessment of genetically modified organisms (GMOs) and as an eco-indicator for global climate change[1] [2].
  • Common Name: Monarch butterfly, Monarch
  • NCBI Taxonomy

Biotic & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A[1] Elongation factor 1α
  • Different development, tissue, and sex under biotic stress
  • Photoperiod, temperature, and dietary RNAi under abiotic stress
DQ157894
  • F:TGTCGCTTTCGTACCCATTT
  • R:CCTTCAGCCTTACCCTCTTTAC
114 55 SYBR
RP49[1] Ribosomal protein 49
  • Different development, tissue, and sex under biotic stress
  • Photoperiod, temperature, and dietary RNAi under abiotic stress
DQ157894
  • F:CCGGAAGGTGTTAGTCCACAAC
  • R:CGGCGCAGTACTTCCTATTCTG
71 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xuguo Zhou
  • Email: xuguozhou@uky.edu
  • Institution: Department of Entomology, University of Kentucky, Lexington, Kentucky, United States of America,

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Pan H, Yang X, Bidne K, et al. (2015) Selection of Reference Genes for RT-qPCR Analysis in the Monarch Butterfly, Danaus plexippus (L.), a Migrating Bio-Indicator. PLoS One 10, e0129482.
  2. Pfeiler E, Nazario-Yepiz NO, Perez-Galvez F, et al. (2017) Population Genetics of Overwintering Monarch Butterflies, Danaus plexippus (Linnaeus), from Central Mexico Inferred from Mitochondrial DNA and Microsatellite Markers. Journal of Heredity 108, 163-175.

Categories