Dendrocalamus latiflorus

From ICG
Jump to: navigation, search

Description

Dendrocalamus latiflorus.png
  • Dendrocalamus latiflorus, an evergreen species locally known as ‘tropical giant bamboo’, distributes widely in southern China and southeast Asia and plays vital roles as valuable natural resources. It is a unique member of the monophyletic BEP clade (Bambusoideae, Ehrhartoideae, Pooideae) in grass family (Poaceae), comprise various woody and herbaceous varieties. Woody bamboos are arborescent and perennial plants characterized by remarkable sizes, woodiness and rather striking life history, which also endow it with considerable economic and environmental significance[1][2].
  • Common Name: Taiwan giant bamboo, Sweet bamboo
  • NCBI Taxonomy

Different Tissues & Ploidy

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Seeds, flowers, leaves, stem, and root
KF484750
  • F:CCGTCAACGACCCCTTCATCACC
  • R:TACTCAGCACCAGCCTCAGCCCA
193 60 SYBR
EF1a[1] Elongation factor 1-alpha
  • Seeds, flowers, leaves, stem, and root
KF484749
  • F:GTTGTTACCTTTGGTCCCAGCGG
  • R:TGGCAGGGTCATCCTTGGAGTTG
175 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Renying Zhuo
  • Email: zhuory@gmail.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People's Republic of China, 2 The Research Institute of Subtropical Forestry, Chinese Academy of Forestry, Fuyang, People's Republic of China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Liu MY, Jiang J, Han XJ, Qiao GR, Zhuo RY (2014) Validation of Reference Genes Aiming Accurate Normalization of qRT-PCR Data in Dendrocalamus latiflorus Munro. PLoS One 9
  2. Bystriakova N, Kapos V, Stapleton C, Lysenko I (2003) Bamboo biodiversity: information for planning conservation and management in the Asia-Pacific region. UNEP-WCMC Biodiversity Series 14.

Categories