Diabrotica virgifera virgifera

From ICG
Jump to: navigation, search

Description

Diabrotica virgifera virgifera-1.jpg
  • The western corn rootworm (WCR), Diabrotica v. virgifera, is one of the most important insect pests of cultivated maize in North America with annual losses in yield and control expenditures exceeding U.S. $1 billion annually. A number of strategies, such as chemical insecticides, crop rotation, biological control and transgenic plants expressing toxins from Bacillus thuringiensis (Bt), have been used to manage rootworm populations [1].
  • Common Name: Western corn rootworm
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
β-actin[1] actin 2
  • Different life stages
NM_001164951
  • F:TCCAGGCTGTACTCTCCTTG
  • R:CAAGTCCAAACGAAGGATTG
133 60 SYBR
RPS9[1] ribosomal protein S9
  • dsRNA treatments
XM_001608220
  • F:AATGTGTCGTTGTCTGAT
  • R:GTCGTTTGGTTCGTATTG
170 60 SYBR
EF1α[1] elongation factor-1α
  • Bt exposure and among different tissues
XM_003705302
  • F:ACCAGATTTGATGGCTTTGG
  • R:CACCCAGAGGAGCTTCAGAC
194 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Thaı ´s Barros Rodrigues
  • Email: thaisbarros.bio@gmail.com
  • Institution: CAPES Foundation, Ministry of Education of Brazil, Brası ´lia, Federal District, Brazil, and Federal University of Lavras, Lavras, Minas Gerais, Brazil

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Rodrigues, Thaís Barros, et al. Validation of reference housekeeping genes for gene expression studies in western corn rootworm (Diabrotica virgifera virgifera). PLoS One 9.10 (2014): e109825.

Categories