Diploptera punctata

From ICG
Jump to: navigation, search

Description

Diploptera punctata.png
  • Diploptera punctata a tropical omnivorous cockroach found in ground litter or burrowing under rocks and logs, is currently known to be truly viviparous. Its embryos develop within the body cavity of females in the brood sac, an invagination of the ventral intersegmental membrane which provides nutritive secretions (milk) to the developing embryos. The main components of this milk are hydrosoluble proteins, rich in many essential amino acids but deficient in methionine and tryptophan which are presumably acquired from the vertically transmitted Blattabacterium. It has also been proven to be an ideal model organism in the study of juvenile hormone (JH)[1][2].
  • Common Name: Pacific beetle cockroach
  • NCBI Taxonomy

During Gonadotrophic Cycle

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Arm[1] Armadillo
  • Corpora allata
KC149902
  • F:GCTACTGCACCACTCACAGAATTATT
  • R:CTGCAGCATACGTTGCAACA
64 60 SYBR
EF1a[1] Elongation factor 1 alpha
  • Corpora allata
JQ086311
  • F:TCGTCTTCCTCTGCAGGATGTCT
  • R:GGGTGCAAATGTCACAACCATACC
109 60 SYBR
Tub[1] α-tubulin
  • Ovary
KC149906
  • F:AAATTACCAACGCTTGCTTTGAA
  • R:TGGCGAGGATCGCATTTT
58 60 SYBR
RpL32[1] Ribosomal protein L32
  • Ovary
KC149903
  • F:GCGCTTCAAGGGCCAGTAC
  • R:TGCTTGGTTTTCTTATTGCTACCA
63 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Stephen S Tobe
  • Email: stephen.tobe@utoronto.ca
  • Institution: Department of Cell and Systems Biology, University of Toronto, 25 Harbord Street, Toronto, Canada

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Marchal E, Hult E F, Huang J, et al. Sequencing and validation of housekeeping genes for quantitative real-time PCR during the gonadotrophic cycle of Diploptera punctata[J]. BMC research notes, 2013, 6(1): 237.
  2. Ayayee PA, Keeney G, Sabree ZL, Mu?oz-Garcia A. Compositional differences among female-associated and embryo-associated microbiota of the viviparous Pacific Beetle cockroach, Diploptera punctata. FEMS Microbiol Ecol. 2017 Apr 18. doi: 10.1093/femsec/fix052.

Categories