Felis catus

Description

• Felis catus is small and typically furry carnivorous mammal. They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines. Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.
• Common Name: Domestic cat, Cat
• NCBI Taxonomy

Snap-Frozen Tissues

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RPL17	Ribosomal protein L17	Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues Liver and kidney tissues Different breeds, sexes, ages, and disease status	AY738264	F:CTCTGGTCATTGAGCACATCC R:TCAATGTGGCAGGGAGAGC	108	58	SYBR
RPL30	Ribosomal protein L30	Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues Liver and kidney tissues Different breeds, sexes, ages, and disease status	AY700577	F:CCTCGGCAGATAAATTGGACTGTC R:TGATGGCCCTCTGGAATTTGAC	111	64	SYBR
RPS7	Clone E472 ribosomal protein S7	Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues Liver and kidney tissues Different breeds, sexes, ages, and disease status	AY800278	F:GTCCCAGAAGCCGCACTTTGAC R:CTCTTGCCCACAATCTCGCTCG	81	69	SYBR
YWHAZ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide	Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues Liver and kidney tissues Different breeds, sexes, ages, and disease status	EF458621	F:GAAGAGTCCTACAAAGACAGCACGC R:AATTTTCCCCTCCTTCTCCTGC	115	65	SYBR
HPRT	Hypoxanthine guanine phosphoribosyl transferase	Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues Liver and kidney tissues Different breeds, sexes, ages, and disease status	EF453697	F:ACTGTAATGACCAGTCAACAGGGG R:TGTATCCAACACTTCGAGGAGTCC	210	60	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference

Contact

• Name: Louis C. Penning
• Email: L.C.Penning@uu.nl
• Institution: Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])