Equus caballus

From ICG
Jump to: navigation, search

Description

Equus caballus.jpg
  • Equus caballus is a mammal of the Perissodactyla order and the Equiidae family. It was domesticated about 6000 years ago and used worldwide for draft, transport, sports, ceremonial exhibitions, research purposes, warfare, crowd control, food (meat, milk) and as source of a variety of products (leather) and medicines. In history, the possibility of horse riding increased transportation and combat ability, leading to the spread of Indo-European cultures and languages[1].
  • Common Name: Horse
  • NCBI Taxonomy

Bronchoalveolar Lavage Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Bronchoalveolar lavage cells inflammatory airway disease
AF083897
  • F:GGTGAAGGTCGGAGTAAACG
  • R:AATGAAGGGGTCATTGATGG
106 70 SYBR
SDHA[1] Succinate dehydrogenase complex subunit A
  • Bronchoalveolar lavage cells inflammatory airway disease
DQ402987
  • F:GAGGAATGGTCTGGAATACTG
  • R:GCCTCTGCTCCATAAATCG
91 70 SYBR
HPRT[1] Hypoxanthine phosphoribosyltransferase
  • Bronchoalveolar lavage cells inflammatory airway disease
AY372182
  • F:AATTATGGACAGGACTGAACGG
  • R:ATAATCCAGCAGGTCAGCAAAG
121 70 SYBR
RPL32[1] Ribosomal protein L32
  • Bronchoalveolar lavage cells inflammatory airway disease
CX594263
  • F:GGGAGCAATAAGAAAACGAAGC
  • R:CTTGGAGGAGACATTGTGAGC
138 70 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Renaud Léguillette
  • Email: rleguill@ucalgary.ca
  • Institution: Departement of Veterinary Clinical and Diagnostic Sciences, Faculty of Veterinary Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1, Canada

Citation Statistics

Cited by 45 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Beekman L, Tohver T, Dardari R, et al. Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage cells from horses with inflammatory airway disease[J]. BMC molecular biology, 2011, 12(1): 5.

Categories