Eremosparton songoricum

From ICG
Jump to: navigation, search

Description

Eremosparton songoricum.png
  • Eremosparton songoricum (Litv.) Vass. is a leafless perennial clone-forming semi-shrub. It is a rare endemic plant of central Asia and is the only species of the genus in China, where it is found only in the Gurbantunggut desert. As a rare and extremely drought-tolerant shrub, it is being developed as a model organism for investigating the morphological, biochemical, physiological and molecular adaptations and responses to water deficit[1][2].
  • Common Name: Fabaceae
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF[1] Elongation factor 1-alpha
  • Various stress conditions
  • Differing germination stages
JN866817
  • F:CGGACATCGTGACTTTATC
  • R:TGTGGTGGCATCCATCTT
199 82.5 SYBR
TUB[1] Alpha-tubulin
  • Various stress conditions
JN866820
  • F:TAGCAGCGTCTTCCTTT
  • R:ATGGTTTGATGCCGAGT
204 82 SYBR
ACT[1] Actin
  • Differing germination stages
JN866816
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
275 83 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Multiple adult tissue samples
JN866814
  • F:AATGTCTTTCCGTGTCC
  • R:TCCTCTTCAATGTAACCC
150 81 SYBR
UBQ[1] Ubiquitin
  • Multiple adult tissue samples
JN866815
  • F:TGGTCGCACCTTAGCCG
  • R:TCCCTCCTTATCTTGAATCTTGG
178 82 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiao-Shuang Li
  • Email: xiaoshuangliok@sina.com
  • Institution: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Li X S, Yang H L, Zhang D Y, et al. Reference gene selection in the desert plant Eremosparton songoricum[J]. International journal of molecular sciences, 2012, 13(6): 6944-6963.
  2. Jian, B.; Liu, B.; Bi, Y.R.; Hou, W.S.; Wu, C.X.; Han, T.F. Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol. Biol. 2008, 9, doi:10.1186/1471-2199-9-59.

Categories