Eucalyptus grandis

From ICG
Jump to: navigation, search

Description

Eucalyptus grandis.png
  • Eucalyptus grandis is one of the most cultivated for industrial purposes, particularly in South Africa and Brazil. Most of the current Eucalyptus production in Brazil is cultivated in an area over 5.4 million hectares. Given its fast growing rates and coppicing ability, eucalyptus has also been identified as a potential feedstock for biofuels. Besides, bark is also a source of nutrients, carbon as well as being used to form a protective covering of soils in commercial plantations[1] [2] .
  • Common Name: Fflooded gum, Gum
  • NCBI Taxonomy

In Vitro Adventitious Rooting

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBI[1] Polyubiquitin
  • Microccuttings rooted in vitro, in presence or absence of auxin
HO048245
  • F:AGAAGGAATCGACCCTCCAC
  • R:CCTTGACGTTGTCAATGGTG
126 60 SYBR
18S[1] RNA ribosomal 18S
  • Microccuttings rooted in vitro, in presence or absence of auxin
HO048251
  • F:TGACGGAGAATTAGGGTTCG
  • R:CCGTGTCAGGATTGGGTAAT
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Arthur G Fett-Neto
  • Email: fettneto@cbiot.ufrgs.br
  • Institution: Center for Biotechnology, Federal University of Rio Grande do Sul, P.O. Box 15005, 91501-970 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 50 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 de Almeida M R, Ruedell C M, Ricachenevsky F K, et al. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill[J]. BMC molecular biology, 2010, 11(1): 73.
  2. Budzinski I G F, Moon D H, Morosini J S, et al. Integrated analysis of gene expression from carbon metabolism, proteome and metabolome, reveals altered primary metabolism in Eucalyptus grandis bark, in response to seasonal variation[J]. BMC Plant Biology, 2016, 16(1): 149.

Categories