Eremosparton songoricum

Description

Eremosparton songoricum (Litv.) Vass. is a leafless perennial clone-forming semi-shrub. It is a rare endemic plant of central Asia and is the only species of the genus in China, where it is found only in the Gurbantunggut desert. As a rare and extremely drought-tolerant shrub, it is being developed as a model organism for investigating the morphological, biochemical, physiological and molecular adaptations and responses to water deficit^[1]^[2].
Common Name: Fabaceae
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF^[1]	Elongation factor 1-alpha	Various stress conditions Differing germination stages	JN866817	F:CGGACATCGTGACTTTATC R:TGTGGTGGCATCCATCTT	199	82.5	SYBR
TUB^[1]	Alpha-tubulin	Various stress conditions	JN866820	F:TAGCAGCGTCTTCCTTT R:ATGGTTTGATGCCGAGT	204	82	SYBR
ACT^[1]	Actin	Differing germination stages	JN866816	F:AGGAACCACCGATCCAGACA R:GGTGCCCTGAGGTCCTGTT	275	83	SYBR
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Multiple adult tissue samples	JN866814	F:AATGTCTTTCCGTGTCC R:TCCTCTTCAATGTAACCC	150	81	SYBR
UBQ^[1]	Ubiquitin	Multiple adult tissue samples	JN866815	F:TGGTCGCACCTTAGCCG R:TCCCTCCTTATCTTGAATCTTGG	178	82	SYBR

Name: Xiao-Shuang Li
Email: xiaoshuangliok@sina.com
Institution: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China

Cited by 11 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Li X S, Yang H L, Zhang D Y, et al. Reference gene selection in the desert plant Eremosparton songoricum[J]. International journal of molecular sciences, 2012, 13(6): 6944-6963.
↑ Jian, B.; Liu, B.; Bi, Y.R.; Hou, W.S.; Wu, C.X.; Han, T.F. Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol. Biol. 2008, 9, doi:10.1186/1471-2199-9-59.