Fagus sylvatica

From ICG
Jump to: navigation, search

Description

Fagus sylvatica.png
  • Fagus sylvatica is one of the most widespread forest trees in Europe, with a natural distribution range of more than 300,000 km2 extending from Sicily to southern Sweden. It is a major timber species, essential to the maintenance of European forest diversity and providing diverse ecosystem services. The area covered by beech has increased steadily in recent decades. This species plays a key role in the current shift from intensely managed plantation forests towards largely self-regenerating mixed broadleaf stands[1][2].
  • Common Name: Beech, European beech
  • NCBI Taxonomy

Abiotic and Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act[1] Actin
  • Concentrations of either ozone or CO2
  • Pathogen infection with Phytophthora citricola
AM063027
  • F:AGAGATTCCGTTGCCCAGAA
  • R:TGGATTCCAGCAGCTTCCA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Dieter Ernst
  • Email: ernst@helmholtz-muenchen.de
  • Institution: Institute of Biochemical Plant Pathology, Helmholtz Zentrum München Ð German Research Center for Environmental Health, D-85764 Neuherberg, Germany

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Olbrich M, Gerstner E, Welzl G, Fleischmann F, Osswald W, Bahnweg G, Ernst D. Quantification of mRNAs and housekeeping gene selection for quantitative real-time RT-PCR normalization in European beech (Fagus sylvatica L.) during abiotic and biotic stress. Z Naturforsch C. 2008 Jul-Aug;63(7-8):574-82. PubMed PMID: 18811005.
  2. Lesur I, Bechade A, Lalanne C, Klopp C, Noirot C, Leplé JC, Kremer A, Plomion C, Le Provost G. A unigene set for European beech (Fagus sylvatica L.) and its use to decipher the molecular mechanisms involved in dormancy regulation. Mol Ecol Resour. 2015 Sep;15(5):1192-204. doi: 10.1111/1755-0998.12373. Epub 2015 Jan 30. PubMed PMID: 25594128.

Categories