Francisella noatunensis

From ICG
Jump to: navigation, search

Description

Francisella noatunensis.png
  • Francisella noatunensis, bacteria from the genus Francisella are characterised as strictly aerobic, facultatively intracellular, non-motile, Gram-negative cocco bacilli. Systemic infection caused by the Gram-negative bacterium remains a serious threat to Atlantic cod Gadhus morhua L. farming in Norway. Similar diseases associated with different strains of F. noatunensis have been reported in both fresh- and seawater farmed fish in Taiwan and Japan Chile, America, and Great Britain[1][2].
  • Common Name: NA
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
fopA[1] Francisella outer membrane protein A
  • Exponential growth conditions
  • Stationary growth conditions
  • Iron-restricted growth conditions
12952182
  • F:TACTGGTGCATGGGATGTTG
  • R:TACTGGTGCATGGGATGTTG
100 60 SYBR
ftsZ[1] Cell division protein
  • Exponential growth conditions
  • Stationary growth conditions
  • Iron-restricted growth conditions
12952792
  • F:TACCATACTCAGCGGCTTTC
  • R:GCGCCTGTAGTTGCTGAAGT
112 60 SYBR
polA[1] DNA polymerase I
  • Exponential growth conditions
  • Stationary growth conditions
  • Iron-restricted growth conditions
12951484
  • F:AGCTGGAACTGGTCGTAATCA
  • R:ATCAGCATCTTCAGCAGCATA
82 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Samuel Duodu
  • Email: samuel.duodu@vetinst.no
  • Institution: Section for Microbiology, Immunology and Parasitology, Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, PO Box 8146 Dep, Oslo 0033, Norway

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Brudal E, Winther-Larsen H C, Colquhoun D J, et al. Evaluation of reference genes for reverse transcription quantitative PCR analyses of fish-pathogenic Francisella strains exposed to different growth conditions[J]. BMC research notes, 2013, 6(1): 76.
  2. Jeffery KR, Stone D, Feist SW, Verner-Jeffreys DW: An outbreak of disease caused by Francisella sp. in Nile tilapia Oreochromis niloticus at a recirculation fish farm in the UK. Dis Aquat Organ 2010, 91:161–165.

Categories