Gadus morhua

From ICG
Jump to: navigation, search

Description

Gadus morhua.png
  • Gadus morhua is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe. It is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas[1][2].
  • Common Name: Atlantic cod
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubi[1] Ubiquitin
  • Gills, brain, liver, head kidney, muscle and middle intestine
EX735613
  • F:GGCCGCAAAGATGCAGAT
  • R:CTGGGCTCGACCTCAAGAGT
69 bp 60 SYBR
ARP[1] Acidic ribosomal protein
  • Gills, brain, liver, head kidney, muscle and middle intestine
EX741373
  • F:TGATCCTCCACGACGATGAG
  • R:CAGGGCCTTGGCGAAGA
113 bp 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

Citation Statistics

Cited by 82 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Olsvik P A, Søfteland L, Lie K K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua[J]. BMC Research Notes, 2008, 1(1): 47.
  2. Johansen S D, Coucheron D H, Andreassen M, et al. Large-scale sequence analyses of Atlantic cod[J]. New Biotechnology, 2009, 25(5): 263-271.

Categories