Gallus gallus

From ICG
Jump to: navigation, search

Description

Gallus gallus.png
  • Gallus gallus is a tropical member of the family Phasianidae, it is the primary progenitor of the domestic chicken. The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a productive food source of both meat and eggs. Gallus gallus is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approximately 9,600 extant avian species [1] [2].
  • Common Name: Red junglefowl
  • NCBI Taxonomy

Lymphoid Organs

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TBP[1] TATA binding protein
  • Chicken lymphoid organs
AF221563
  • F:AGCTCTGGGATAGTGCCACAG
  • R:ATAATAACAGCAGCAAAACGCTTG
134 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Chicken lymphoid organs
AF047874
  • F:GAAGGCTGGGGCTCATCTG
  • R:CAGTTGGTGGTGCACGATG
150 60 SYBR
r28S[1] 28S rRNA gene
  • Chicken lymphoid organs
FM165415
  • F:GGCGAAGCCAGAGGAAACT
  • R:GACGACCGATTTGCACGTC
62 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: D. Borowska
  • Email: dominika.borowska@roslin.ed.ac.uk
  • Institution: The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Embryo Fibroblasts

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[2] Beta-actin
  • In chicken embryo fibroblast following NDV treatment over a time up to 72 h
L08165
  • F:CAGACATCAGGGTGTGATGG
  • R: TCAGGGGCTACTCTCAGCTC
183 NA SYBR
HPRT1[2] Hypoxanthine phosphorribosyltransferase 1
  • In chicken embryo fibroblast following NDV treatment over a time up to 73 h
NM_204848
  • F: TGGTGGGGATGACCTCTCAA
  • R: GGCCGATATCCCACACTTCG
177 NA SYBR
HMBS[2] Hydroxymethylbilane synthase
  • In chicken embryo fibroblast following NDV treatment over a time up to 74 h
XM_417846
  • F: GGCTGGGAGAATCGCATAGG
  • R: GGCCGATATCCCACACTTCG
131 NA SYBR

Molecular types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhuang Ding
  • Email: renfu.yin@helmholtz-muenchen.de
  • Institution: Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P (2016) Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 170, 20-24.
  2. 2.0 2.1 2.2 2.3 Yin R, Liu X, Liu C, et al. Systematic selection of housekeeping genes for gene expression normalization in chicken embryo fibroblasts infected with Newcastle disease virus[J]. Biochemical and biophysical research communications, 2011, 413(4): 537-540.

Categories