Ganoderma lucidum

From ICG
Jump to: navigation, search

Description

Ganoderma lucidum-1.jpg
  • Ganoderma lucidum, a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium [1][2].
  • Common Name: Ling zhi
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] protein phosphatase 2A
  • Different fermentation conditions
GL15755
  • F:CACGCTTATCATATCCACTCCA
  • R:GGCTTGATGTCCACGATGTT
131 60 SYBR
RPL4[1] ribosomal protein L4
  • Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
GL25990
  • F:GTCAACAAGGGCGTTCTCTT
  • R:ACAGCGTCTTGAGGAAGGT
151 60 SYBR
BTU[1] β-tubulin
  • Different fermentation conditions
  • Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
GL27826
  • F:CAGTTCACGGCGATGTTCA
  • R:CGACGGTAGCATCCTGGTA
142 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jiang Xu
  • Email: xj8442cn@gmail.com
  • Institution: The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Xu J, Xu Z, Zhu Y, Luo H, Qian J, Ji A, Hu Y, Sun W, Wang B, Song J, Sun C, Chen S. Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum. Curr Microbiol. 2014 Jan;68(1):120-6. doi: 10.1007/s00284-013-0442-2. Epub 2013 Sep 8. PubMed PMID: 24013612.
  2. Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S. Genome-wide analysis of simple sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene. 2013 Jan 10;512(2):331-6. doi: 10.1016/j.gene.2012.09.127. Epub 2012 Oct 13. PubMed PMID: 23069850.

Categories