Fragaria ananassa

From ICG
(Redirected from Garden strawberry)
Jump to navigation Jump to search

Description

Fragaria ananassa.png
  • Fragaria ananassa Duch is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases[1][2].
  • Common Name: Garden strawberry,Strawberry
  • NCBI Taxonomy

Different Cultivars & Osmotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
DBP[1] DNA binding protein
  • Drought stress
EU727547
  • F:TTGGCAGCGGGACTTTACC
  • R:CGGTTGTGTGACGCTGTCAT
NA 79.54 SYBR
HISTH4[1] Histone H4
  • Osmotic stress
  • Salt stress
AB197150.1
  • F:GTGGCGTCAAGCGTATCTCC
  • R:TGTCCTTCCCTGCCTCTTGA
167 88.27 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Vanessa Galli
  • Email: vane.galli@yahoo.com.br
  • Institution: Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil

Citation Statistics

Cited by 26 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
FaRIB413[3] RNA interspacer (16S–23S) region
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
gene33863 (Fragaria vesca orthologe (a))
  • F:ACCGTTGATTCGCACAATTGGTCATCG
  • R:TACTGCGGGTCGGCAATCGGACG
149 65 SYBR
FaACTIN[3] Actin
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
Actin (Fragaria vesca orthologe (a))
  • F:GGGCCAGAAAGATGCTTATGTCGG
  • R:GGGCAACACGAAGCTCATTGTAGAAG
152 65 SYBR
FaEF1α[3] Elongation factor 1-alpha
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
gene28639, gene28622,gene23217(Fragaria vesca orthologe (a))
  • F:TGGATTTGAGGGTGACAACATGA
  • R:GTATACATCCTGAAGTGGTAGACGGAGG
145 65 SYBR
FaGAPDH2[3] Glyceraldehyde-3-phosphate dehydrogenase
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
gene07104 (Fragaria vesca orthologe (a))
  • F:CCCAAGTAAGGATGCCCCCATGTTCG
  • R:TTGGCAAGGGGAGCAAGACAGTTGGTAG
117 65 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jose´ L. Caballero
  • Email: bb1carej@uco.es
  • Institution: Departamento de Bioquı ´mica y Biologı ´a Molecular e Instituto Andaluz de Biotecnologı ´a, Campus Universitario de Rabanales y Campus de Excelencia Internacional Agroalimentario-CEIA3, Universidad de Co´rdoba, Co´rdoba, Andalucı ´a, Spain

Citation Statistics

Cited by 35 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Galli V, Borowski JM, Perin EC, et al. (2015) Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses. Gene 554, 205-214.
  2. Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.
  3. 3.0 3.1 3.2 3.3 Amil-Ruiz, Francisco, et al. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria× ananassa) defense responses. PloS one 8.8 (2013): e70603.

Categories