Salicornia europaea

Description

Salicornia europaea is a widely distributed salt-tolerant plant species that produces numerous dimorphic seeds. This annual halophyte almost ubiquitously occupies inland salt marshes of the globe. It has long attracted interest due to its high salt tolerance, reclamation potential, and high pharmaceutical and culinary value. S. europaea reproduces sexually and produces a large number of dimorphic seeds that differ in size and plant position^[1]^[2].
Common Name: Common glasswort, Glasswort
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CAC^[1]	Clathrin adaptor complexes	Universial reference gene	Unigene31433_All	F:CGTGCCTTCTGATGCGACTA R:TGCCTCTTCACTTGTGATGCT	166	60	SYBR
UBC^[1]	Ubiquitin-conjugating enzyme	Universial reference gene	Unigene40024_All	F:GGGCCAGTCGGTGAAGACAT R:ATGCAACCTTTGGGGGCTTGA	136	60	SYBR
ACT^[1]	Actin	Nitrogen treatment,drought stress & various developmental stages	Unigene31801_All	F:TGTTGGTCGGCCTAGACACACT R:AATGGGGCCTCGGTAAGCAAC	228	60	SYBR
α-Tub^[1]	α-tubulin	Nitrogen treatment,drought stress & cold stress	Unigene41384_All	F:CCACCAGTGCCTTTGAGCCA R:GCCACAGCAGCGTTCACATC	124	60	SYBR
GAPDH^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Drought stress	Unigene17282_All	F:TGGCAAAGGTTAAGATCGGAATCA R:ACGAAGTCAGCTCCTGTGGC	289	60	SYBR
TIP41^[1]	TIP41-like protein	Drought stress	Unigene4197_All	F:AGGAAAGCTGCTGGAGAGAGTG R:GGAGCCTCTGGCTAATAGTGCT	105	60	SYBR
DNAJ^[1]	DnaJ-like protein	Heat stress	Unigene19716_All	F:TGCCATCAGATCAGTGCAAGT R:TCTTCGTAAGCCTCTTGCTGG	169	60	SYBR
UBQ^[1]	Polyubiquitin	Heat stress	Unigene67832_All	F:ACGCTGGAGGTCGAAACATC R:TATAATCCGCCAGTGTCCTGC	139	60	SYBR

Name: Yinan Ya
Email: yaoya@ms.xjb.ac.cn
Institution: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi, China

Cited by 26 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 Xiao X, Ma J, Wang J, et al. (2014) Validation of suitable reference genes for gene expression analysis in the halophyte Salicornia europaea by real-time quantitative PCR. Front Plant Sci 5, 788.
↑ (2016) Effect of salinity on seed germination, growth and ion content in dimorphic seeds of Salicornia europaea L. (Chenopodiaceae). Plant Diversity 38, 183-189.