Gluconacetobacter diazotrophicus

From ICG
Jump to: navigation, search

Description

Gluconacetobacter diazotrophicus-1.jpg
  • Gluconacetobacter diazotrophicus strain PAL5 is a nitrogen-fixing endophytic bacterium originally isolated from sugarcane and later on was found to colonize other plants such as rice, elephant grass, sweet potato, coffee, and pineapple. Currently, G. diazotrophicus has been considered a plant growth-promoting bacterium due to its characteristics of biological nitrogen fixation, phytohormone secretion, solubilization of mineral nutrients and antagonism to phytopathogens [1][2].
  • Common Name: NA
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rho[3] Rho termination factor
  • LGI medium and LGI medium
NM_003134
  • F:GCAACTCGGAACTCATCCTC
  • R:GGACCCACATCTTCGACAGT
132 58 SYBR
23S rRNA[3] Ribosomal RNA subunit 23S
  • LGI medium and LGI medium
NM_003135
  • F:GTGAGACAGTTCGGTCCCTATC
  • R:CGATTATCCCGTCCAGACTTAG
150 58 SYBR
rpoD[3] RNA polymerase Sigma factor RpoD
  • LGI medium and LGI medium
NM_003136
  • F:ACAACGACACCACTCTGCTG
  • R:CTCCGACGACATCTGATCCT
131 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jean L. Simões-Araújo
  • Email: jean@cnpab.embrapa.br
  • Institution: Laboratório de Genética e Bioquímica, Embrapa Agrobiologia, Seropédica, RJ, Brazil

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-09-01])

References

  1. Péricles S. Galisa a,d,e, Helder A.P. da Silva b,e, Aline V.M. Macedo c, Verônica M. Reis d, Márcia S. Vidal e, José I. Baldani e, Jean L. Simões-Araújo. Identification and validation of reference genes to study the gene expression in Gluconacetobacter diazotrophicus grown in different carbon sources using RT-qPCR. J Microbiol Methods. 2012 Oct;91(1):1-7. doi:10.1016/j.mimet.2012.07.005. Epub 2012 Jul 16. PubMed PMID: 22814372.
  2. Stevenson DM, Weimer PJ. Expression of 17 genes in Clostridium thermocellum ATCC 27405 during fermentation of cellulose or cellobiose in continuous culture. Appl Environ Microbiol. 2005 Aug;71(8):4672-8. PubMed PMID: 16085862; PubMed Central PMCID: PMC1183361.
  3. 3.0 3.1 3.2 Galisa, Péricles S., et al. Identification and validation of reference genes to study the gene expression in Gluconacetobacter diazotrophicus grown in different carbon sources using RT-qPCR. Journal of microbiological methods 91.1 (2012): 1-7.

Categories