Gossypium hirsutum

From ICG
Jump to: navigation, search

Description

Gossypium hirsutum.png
  • Gossypium hirsutum L. is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development. It is one of the most important cash crops that provide fiber to the textile industries around the world. It contributes a major portion to the gross national product (GNP) of many countries[1][2][3].
  • Common Name: Upland cotton, Mexican cotton
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GhUBQ7[1] Ubiquitin extension protein 7
  • Leaves & roots under salt stress and drought stress
DQ116441
  • F:GAATGTGGCGCCGGGACCTTC
  • R:ACTCAATCCCCACCAGCCTTCTGG
101 60 TaqMan
GhGAPDH[1] Glyceraldehyde-3-phosphate dehydroge- nase C subunit
  • Leaves & roots under salt stress and drought stress
FJ415206
  • F:TGATGCCAAGGCTGGAATTGCTT
  • R:GTGTCGGATCAAGTCGATAACACGG
106 60 TaqMan
GhEF1A8[1] Translation elongation factor 1A-8
  • Leaves & roots under salt stress and drought stress
DQ174257
  • F:TGAGACAGACTGTTGCTGTTGGTG
  • R:ACCAAAGTTCACTTGCCACCCTTC
109 60 TaqMan
GhTUA10[1] Alpha-tubulin 10
  • Roots under salt stress
  • Leaves & roots under drought stress
FJ594490
  • F:CACGTGAAGATCTCGCTGCCCT
  • R:ACGGTACATCCCTCAATACTCCTCC
104 60 TaqMan
GhCYP1[1] Cydophilin 1
  • Roots under drought stress
GQ292530
  • F:CACCATGGCCTCAAATCCCAAGGT
  • R:CTCCGCAGTGCGAGGAGTGC
109 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Baohong Zhang
  • Email: zhangb@ecu.edu
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 34 (Based on Google Scholar [2017-09-01])

Fiber Development & Somatic Embryogenesis

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Histone3[2] Histone 3 
  • Fiber development and somatic embryogenesis
AF024716
  • F:TCAAGACTGATTTGCGTTTCCA
  • R:GCGCAAAGGTTGGTGTCTTC
100 60 SYBR
UBQ7[2] Ubiquitin extension protein 
  • Fiber development and somatic embryogenesis
DQ116441
  • F:GAAGGCATTCCACCTGACCAAC
  • R:CTTGACCTTCTTCTTCTTGTGCTTG
198 60 SYBR
Gbpolyubiquitin-1[2] Fiber polyubiquitin
  • Fiber development and somatic embryogenesis
AY375335
  • F:AGCTCGGATACGATTGATAACG
  • R:GAAGACGAAGAACAAGGGGAAG
166 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: ZHANG XianLong
  • Email: xlzhang@mail.hzau.edu.cn
  • Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

Citation Statistics

Cited by 51 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GhPP2A1[4] Catalytic subunit of protein phosphatase 2A
  • Distinct plants organs
DT545658
  • F:GATCCTTGTGGAGGAGTGGA
  • R:GCGAAACAGTTCGACGAGAT
1301 60~61 SYBR
GhUBQ14[4] Ubiquilin
  • Distinct plants organs
  • Flower development
DW505546
  • F:CAACGCTCCATCTTGTCCTT
  • R:TGATCGTCTTTCCCGTAAGC
1502 60~61 SYBR
GhACT4[4] Actin gene family
  • Flower development
  • Floral verticils
AY305726
  • F:TTGCAGACCGTATGAGCAAG
  • R:ATCCTCCGATCCAGACACTG
1700 60~61 SYBR
GhFBX6[4] F-box family protein
  • Floral verticils
DR463903
  • F:TGCCTGCAGTAAATCTGTGC
  • R:GGGTGAAAGGGTTTCCAAAT
1884 60~61 SYBR
GhMZA[4] Clathrin adaptor complexes medium subunit family protein
  • Fruit development
DT571956
  • F:CCGTCAGACAGATTGGAGGT
  • R:AAAGCAACAGCCTCAACGAC
1853 60~61 SYBR
GhPTB[4] Polypyrimidine tract-binding protein homolog
  • Fruit development
DT571956
  • F:GGTTACCATTGAGGGTGTGG
  • R:GTGCACAAAACCAAATGCAG
1511 60~61 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marcio Alves-Ferreira
  • Email: alvesfer@biologia.ufrj.br
  • Institution: Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil

Citation Statistics

Cited by 200 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Wang M, Wang Q, Zhang B. Evaluation and selection of reliable reference genes for gene expression under abiotic stress in cotton (Gossypium hirsutum L.)[J]. Gene, 2013, 530(1): 44-50.
  2. 2.0 2.1 2.2 2.3 Tu L L, Zhang X L, Liu D Q, et al. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis[J]. Chinese Science Bulletin, 2007, 52(22): 3110-3117.
  3. Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).
  4. 4.0 4.1 4.2 4.3 4.4 4.5 Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49.

Categories