Ulva linza

Description

Ulva linza is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies, which reproduces by production of spores that rapidly develop into sporelings. It is well known for its distribution in all aquatic habitats including freshwater, brackish environments, marine and fully saline environments throughout the warm temperate and tropical regions of the world. It must cope with dramatic changes because of tidal changes in light intensity, temperature, salinity, and wave action and with the biotic stresses characteristic of dense coastal ecosystems^[1]^[2].
Common Name: Green alga
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
TUB2^[1]	Tubulin2	Salinity treatments UV treatments	JN543389	F:TGGAATCAACTACCAGCCAC R:CGTACATCAGGTCAAACTTGTG	NA	60	SYBR
H2^[1]	Histone 2	Different temperature treatments Desiccation stress treatments	JN543390	F:CTACAAGACAGACCTTCGCTTC R:CATCCTTGGGCATAATAGTGAC	NA	60	SYBR
18S^[1]	18S rRNA	Different light intensity treatments	HM584731	F:TGCCTAGTAAGCGCGAGTCA R:AAACGATGGGCAGGGAAAC	NA	60	SYBR

Cited by 20 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Dong M, Zhang X, Chi X, et al. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza[J]. Current genetics, 2012, 58(1): 13-20.
↑ Heydt M, Div車s P, Grunze M, Rosenhahn A. 2009. Analysis of holographic microscopy data to quantitatively investigate three-dimensional settlement dynamics of algal zoospores in the vicinity of surfaces. Eur Phys J E. 30:141-148.