Aphis gossypii

Description

Aphis gossypii, the cotton aphid, is a tiny greenfly that sucks sap from plants. It belongs to the superfamily Aphidoidea in the order Hemiptera. It is a widely distributed pest of a variety of agriculturally important crops in the families Cucurbitaceae, Rutaceae and Malvaceae, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China ^[1] ^[2].
Common Name: Greenfly, Cotton aphid, Melon aphid
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF1α^[1]	Elongation factor 1 alpha	Divergent developmental stages Different geographical populations	EU019874.1	F:GAAGCCTGGTATGGTTGTCGT R:GGGTGGGTTGTTCTTTGTG	187	60	SYBR
β-ACT^[1]	beta-actin	Divergent developmental stages Different geographical populations	KF018928.1	F:TCTTGGGAATGGAATCTTGC R:GGACAGAGAAGCCAAGATGG	254	60	SYBR
RPL7^[1]	Ribosomal protein L7	Divergent developmental stages Experiments of the temperature changes	KP676382	F:TGCCGGAGTCTGTACTCAA R:TCACACCACGAATACGCA	255	60	SYBR
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Experiments of the temperature changes	KP676380	F:ACTACTGTTCATGCAACCACCG R:GCTGCTTCCTTAACCTTATCCT	272	60	SYBR
18S^[1]	18S ribosomal	Feeding assay experiments	KF018922.1	F:ATTGACGGAAGGGCACC R:CGCTCCACCAACTAAGAACG	157	60	SYBR

Name: Xi-Wu Gao
Email: gaoxiwu@263.net.cn
Institution: Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China

Cited by 7 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Ma KS, Li F, Liang PZ, et al. (2016) Identification and Validation of Reference Genes for the Normalization of Gene Expression Data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae). J Insect Sci 16.
↑ Cao CW, Zhang J, Gao XW, Liang P, Guo HL (2008) Overexpression of carboxylesterase gene associated with organophosphorous insecticide resistance in cotton aphids, Aphis gossypii (Glover). Pesticide Biochemistry and Physiology 90, 175-180.