Haliotis discus hannai

From ICG
Jump to: navigation, search

Description

Haliotis discus hannai.png
  • Haliotis discus hannai is herbivorous marine gastropods which has been used as a human food source in the Asia-Pacific region for many years. In China, abalone farming has become an important sector of the aquaculture industry. However, in recent years, abalone culture has faced increasing problems associated with microbial diseases[1][2].
  • Common Name: Pacific abalone
  • NCBI Taxonomy

Bacterial Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A[1] Elongation factor-1-а
  • Presence & Absence of Bacterial Infection
JX002677
  • F:TGCTGTCTGATCGTTGCCT
  • R:GCTGTCCATCTTGTTGATTCCA
138 60 SYBR
ACTB[1] Actin
  • Presence & Absence of Bacterial Infection
AY380809
  • F:GGTTCACCATCCCTCAAGTACCC
  • R:GGGTCATCTTTTCACGGTTGG
138 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: LIU Xiao
  • Email: liuxiao@qdio.ac.cn
  • Institution: Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Qiu R, Sun B, Fang S, et al. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai[J]. Chinese Journal of Oceanology and Limnology, 2013, 31(2): 421-430.
  2. Zhang G F, Que H Y, Liu X, Xu H S. 2004. Abalone mariculture in China. J. Shellfish Res., 23(4): 947-950.

Categories