Haliotis rufescens

From ICG
Jump to: navigation, search

Description

Haliotis rufescens.png
  • Haliotis rufescens is one of the most important species for aquaculture in Baja California, México. The longitudinal cross-section of H. rufescens shows two types of microstructure: an outer prismatic layer, and an inner nacreous layer. The two forms of CaCO3, calcite and aragonite constitute the inorganic component of this ceramic/organic composite. Currently, there is an apparent skewed sex ratio, where males are changing to females, and this affects broodstock availability to obtain larvae at commercial scale. Increasing interest has been put in studying aspects such as reproduction, thermoregulation and endocrinology[1][2].
  • Common Name: Red abalone
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HPRTI[1] Hypoxanthine phosphoribosyltransferase 1
  • Gill and gonad/digestive gland
KJ188156
  • F:ACGACATCTCAACAGGGAACATC
  • R:GACTTGGGCTTCACTTCCTTCA
151 60 SYBR
RPL5[1] Ribosomal protein L5
  • Head and gonad/digestive gland
KJ188157
  • F:TCACCAACAAGGACATCATTTGTC
  • R:CAGGAGGAGTCCAGTGCAGTATG
152 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Miguel A. Del Río-Portilla
  • Email: mdelrio@cicese.mx
  • Institution: Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens.

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Lopez-Landavery EA, Portillo-Lopez A, Gallardo-Escarate C, Del Rio-Portilla MA (2014) Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens (Mollusca, Vetigastropoda; Swainson, 1822). Gene 549, 258-265.
  2. Menig R, Meyers MH, Meyers MA, Vecchio KS (2000) Quasi-static and dynamic mechanical response of Haliotis rufescens (abalone) shells. Acta Materialia 48, 2383-2398.

Categories