Helicoverpa armigera

From ICG
Jump to: navigation, search

Description

Helicoverpa armigera.png
  • Helicoverpa armigera, the cotton bollworm or corn ear worm, is one of the most serious agricultural pests in Asia, Africa, southern Europe and Australia. Due to heavy selection pressure over the past 40 years, it has developed resistance to organochlorine, carbamate, organophosphate and pyrethroid insecticides in many countries and has begun to show some tolerance to newer chemistries such as fipronil, chlorfenapyr, spinosad and indoxacarb. The failure of insecticides to control resistant H. armigera has been a strong incentive for the development and adoption of Bt cotton genetically engineered to withstand bollworm attack[1] [2].
  • Common Name: Cotton bollworm
  • NCBI Taxonomy

Different Biotic and Abiotic conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL32[1] Ribosomal protein L32
  • Universal reference gene (especially for insecticide treatment)
JQ744274.1
  • F:CATCAATCGGATCGCTATG
  • R:CCATTGGGTAGCATGTGAC
152 60 SYBR
RPS15[1] Ribosomal protein S15
  • Different developmental stages & larvae tissues
  • Insecticide & temperature treatment
AY818611.1
  • F:CTGAGGTCGATGAAACTCTC
  • R:CTCCATGAGTTGCTCATTG
107 60 SYBR
RPL27[1] Ribosomal protein L27
  • Adult tissues
  • Nuclear polyhedrosis virus infection
  • Temperature treatment
DQ875214.1
  • F:ACAGGTATCCCCGCAAAGTGC
  • R:GTCCTTGGCGCTGAACTTCTC
155 60 SYBR
28S[1] 28S ribosomal RNA
  • Adult tissues
  • Nuclear polyhedrosis virus infection
  • Temperature treatment
GU350477.1
  • F:CGATAGCGAACAAGTACCGT
  • R:TTCGAGTTTCGCAGGTTTAC
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaoxia Liu
  • Email: liuxiaoxia611@cau.edu.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing 100193, China

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Zhang S, An S, Li Z, et al. (2015) Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 555, 393-402.
  2. Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentially regulated inhibitor-sensitive and insensitive protease genes from the phytophagous insect pest, Helicoverpa armigara, are members of complex multigene families. Insect Biochemistry and Molecular Biology 27, 625-638.

Categories