Hevea brasiliensis

From ICG
Jump to: navigation, search

Description

Hevea brasiliensis.png
  • Hevea brasiliensis, also known as Pará rubber tree in Brazil, belonging to Hevea in Euphorbiaceae, is originated in the Amazon River basin, Brazil, and now is distributed in more than 40 countries and areas in Asia, Africa, Oceania, and Latin America. It is the major source for natural latex production and one of the economically important crops[1][2].
  • Common Name: Rubber tree
  • NCBI Taxonomy

Different Genotypes & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBC2b [1] Ubiquitin-conjugating enzyme E2
  • Individual trees
HQ323247
  • F:CGACCAAGTTTTCATTTCGGGTG
  • R:AGTCTCTTCTTTGCTGGGGTTG
95 60 SYBR
RH2b[1] DEAD box RNA helicase 
  • Individual trees
HQ323243
  • F: AGGTGGATTGGCTAACTGAG
  • R: GAGCCCAAACATCAGTAGTG
150 60 SYBR
YLS8[1] Mitosis protein
  • Hormone-treated samples
HQ323250
  • F: CCTCGTCGTCATCCGATTC
  • R: CAGGCACCTCAGTGATGTC
131 60 SYBR
RH8[1] DEAD/DEAH box helicase 8
  • Hormone-treated samples
HQ323244
  • F: TCACAGGGTTGGTAGATCAG
  • R: CCAAGCTCTTGCTCAATCC
105 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chaorong Tang
  • Email: chaorongtang@126.com
  • Institution: Key Lab of Rubber Biology, Ministry of Agriculture & Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan 571737, China

Citation Statistics

Cited by 82 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Li H, Qin Y, Xiao X, et al. Screening of valid reference genes for real-time RT-PCR data normalization in Hevea brasiliensis and expression validation of a sucrose transporter gene HbSUT3[J]. Plant Science, 2011, 181(2): 132-139.
  2. Hou B, Feng S, Wu Y.Systemic Identification of Hevea brasiliensis EST-SSR Markers and Primer Screening.J Nucleic Acids. 2017;2017:6590902. doi: 10.1155/2017/6590902. Epub 2017 Jan 23.PMID: 28232872 PMCID: PMC5292370.

Categories