Hibiscus cannabinus

From ICG
Jump to: navigation, search

Description

Hibiscus cannabinus.png
  • Hibiscus cannabinus is an annual herbaceous crop of the Malvaceae family that is mostly grown in tropical regions of Asia and Africa. It has great potential applications in the pulp and paper industry, oil absorption and potting media, board making, filtration media, and animal feed. It has also been identified as an appealing alternative fiber source for the manufacture of a large range of paper products, because it requires less energy and chemical inputs for processing compared with standard wood sources[1] [2].
  • Common Name: Kenaf
  • NCBI Taxonomy

Salinity & Drought Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUBα[1] Alpha-tubulin
  • Excess salinity and drought
NA
  • F:AATGCTTGCTGGGAGCTTTA
  • R:GGTTCACCTACGGAAACCTTG
213 60 SYBR
18S [1] 18S rRNA
  • Excess salinity and drought
NA
  • F:CTACGTCCCTGCCCTTTGTA
  • R:CTACGTCCCTGCCCTTTGTA
175 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jianguang Su
  • Email: jgsu@vip.163.com
  • Institution: Key Laboratory for Genetics, Breeding and Multiple Utilization of Crops, Fujian Agriculture and Forestry University, Fuzhou, China

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Niu X, Qi J, Chen M, et al. (2015) Reference genes selection for transcript normalization in kenaf (Hibiscus cannabinus L.) under salinity and drought stress. PeerJ 3, e1347.
  2. Ayadi R, Hamrouni L, Hanana M, et al. (2011) In vitro propagation and regeneration of an industrial plant kenaf (Hibiscus cannabinus L.). Industrial Crops and Products 33, 474-480.

Categories