Musca domestica

Description

M. domestica, the common house fly, has a complete metamorphosis with distinct egg, larva or maggot, pupal, and adult stages and is known to be a vector of many human and animal pathogens. In humans and animals, many diseases including typhoid, cholera, bacillary dysentery, tuberculosis, anthrax ophthalmia, infantile diarrhea, and parasitic worms are caused by more than 100 pathogens that have been associated with M. domestica. Because of its remarkable immune defenses, M. domestica is capable of living with such pathogens without any ill effects^[1]^[2]^[3].
Common Name: Housefly
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase-like	Injury and bacterial challenge for third instar larvae Egg, first, second and third instar larvae, early and late pupae, and adults	JX427558	F:GACAACTACTCACTCTTACACCG R:GTTCGGGAGGACAAGGGAAA	150	60	SYBR
EF1a^[1]	Elongation factor 1 alpha-like	Injury and bacterial challenge for third instar larvae Egg, first, second and third instar larvae, early and late pupae, and adults	JX427558	F:CCATACCAGCATCACCATTCTTC R:GTCACACTTCCCACATTGCC	117	60	SYBR

Name: Jifang Wen
Email: jifangw@yahoo.com
Institution: Department of Pathology, School of Basic Medical Sciences, Central South University, Changsha 410013, China

Cited by 9 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 Zhong M, Wang X, Wen J, et al. Selection of reference genes for quantitative gene expression studies in the house fly (Musca domestica L.) using reverse transcription quantitative real-time PCR[J]. Acta Biochim Biophys Sin, 2013, 45(12): 1069.
↑ Pavela R. Insecticidal properties of several essential oils on the house fly (Musca domestica L.). Phytother Res 2008, 22: 274–278.
↑ Naitza S and Ligoxygakis P. Antimicrobial defences in Drosophila: the story so far. Mol Immunol 2004, 40: 887–896.