Humulus lupulus

From ICG
Jump to: navigation, search

Description

Humulus lupulus.png
  • Humulus lupulus is a species of flowering plant in the Cannabaceae family, native to Europe, western Asia and North America. It is a dioecious, perennial, herbaceous climbing plant which sends up new shoots in early spring and dies back to a cold-hardy rhizome in autumn. They have stiff downward facing hairs that provide stability and allow them to climb. They have fragrant wind pollinated flowers that attract butterflies, the female flowers are used as a preservative and as a flavoring agent in beer[1][2].
  • Common Name: Common hop, Hop
  • NCBI Taxonomy

Bacteria Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
YLS8[1] Yellow leaf specific protein 8
  • Infection with vascular pathogen verticillium albo-atrum
NM_120912
  • F:CGTACCTGCTTCCACATTTGC
  • R:TCCCAGTCGTGGCCAAAA
NA 60 SYBR
DRH1[1] DEAD box RNA helicase
  • Infection with vascular pathogen verticillium albo-atrum
NA
  • F:CCAACCTACTGGGCTTCGAC
  • R:CAGAATGGGTATGATCGGGC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Branka Javornik
  • Email: branka.javornik@bf.uni-lj.si
  • Institution: Biotechnical Faculty, Agronomy Department, University of Ljubljana, Ljubljana, Slovenia

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Štajner N, Cregeen S, Javornik B. Evaluation of reference genes for RT-qPCR expression studies in hop (Humulus lupulus L.) during infection with vascular pathogen Verticillium albo-atrum[J]. Plos One, 2013, 8(7): e68228.
  2. S. R. Milligan, J. C. Kalita, A. Heyerick, H. Rong, L. De Cooman, D. De Keukeleire; Identification of a Potent Phytoestrogen in Hops (Humulus lupulus L.) and Beer. J Clin Endocrinol Metab 1999; 84 (6): 2249. doi: 10.1210/jcem.84.6.5887.

Categories