Hyriopsis cumingii

From ICG
Jump to: navigation, search

Description

Hyriopsis cumingii.png
  • Hyriopsis cumingii is a kind of freshwater bivalve mollusk that belongs to the Unionidae family. It is economically important for aquaculture since its production has reached about 70% of the freshwater pearls production in China. The freshwater mussel prisms comprise aragonite which provides a model system for the study of cacO 3 crystal polymorphism. However, serious infectious diseases have led to the low quality of the pearl, the output value is only 10% of the total world pearl value[1][2].
  • Common Name: Triangle sail mussel
  • NCBI Taxonomy

During Biomineralization

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubiq[1] Ubiquitin
  • During shell or pearl formation
GW695428
  • F:TCCAGGACAAAGAAGGGATTCC
  • R:AGGGCTCTCAAGCTGGGTTCAA
166 60 SYBR
Rpl18[1] Ribosomal protein L18
  • During shell or pearl formation
GW695428
  • F:TCCCTGGCCAAGCTGGTTCG
  • R:CAGGGCCAACTGATCAAATGTGA
201 60 SYBR
EF1α[1] Elongation factor 1-alpha
  • During shell or pearl formation
GW694601
  • F:GGAACTTCCCAGGCAGACTGTGC
  • R:TCAAAACGGGCCGCAGAGAAT
191 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jiale Li
  • Email: jlli2009@126.com
  • Institution: Key Laboratory of Freshwater Fishery Germplasm Resources, Ministry of Agriculture, Shanghai Ocean University, Shanghai, China

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Bai Z, Lin J, Ma K, et al. (2014) Identification of housekeeping genes suitable for gene expression analysis in the pearl mussel, Hyriopsis cumingii, during biomineralization. Mol Genet Genomics 289, 717-725.
  2. Zhang HW, Huang Y, Man X, et al. (2017) HcToll3 was involved in anti-Vibrio defense in freshwater pearl mussel, Hyriopsis cumingii. Fish & Shellfish Immunology 63, 189-195.

Categories