Iris hybrid cultivar

From ICG
Jump to: navigation, search

Description

Iris hybrid cultivar.png
  • Iris. lactea var. chinensis belongs to the family of Iridaceae, is an herbaceous perennid native to China, Korea, Japan and Russia. It has developed root system and is highly tolerant of Cu, Pb, NaCl, drought and cold. The high resistibility, adaptability and saline-tolerance determine that it is very suitable for the green transformation and the water and soil conservation in the regions with dry climate. Its dried seeds have the effects of clearing heat, eliminating dampness and stanching bleed. It has been used in the treatment of jaundice, diarrhea, vomiting blood, leucorrhea, pharyngitis, and carbuncle swollen in traditional Chinese medicine[1][2].
  • Common Name: Dutch iris
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TIP41[1] TIP41-like family protein
  • PEG & NaCl & Cu & cold treatments
AB907792
  • F:ATGAGTTGGCTGATAATGGA
  • R:CGAAGAACGACAGAGGTGGC
175 81.1 SYBR
CYP[1] Cyclophilin
  • Cu treatments
AB907794
  • F:GACCAGAGGCATGTCGTATT
  • R:TGACCACCTTCTTCTTAGGG
109 60 SYBR
PGK[1] Cytosolic phosphoglycerate kinase
  • PEG & NaCl treatments
AB907791
  • F:TTATTGCCTACTGATGTAGTTGTG
  • R:TGACTGTCTTGGTCGTGTCC
160 85.1 SYBR
GAP[1] Glyceralde hyde-3- phosphate dehydrogen ase
  • Cu & Cold treatments
EX953414
  • F:CCGTTCATTACCACCGATTA
  • R:AGTGAGCAGCAGCCTTGTCC
235 60 SYBR
PP2Acs[1] Phosphatase 2A
  • Cold & NaCl & Pb treatments
AB907791
  • F:GATGCGAACGGTATCACTTA
  • R:CTCAGCAGCACCTTCTTTAT
246 82.4 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Su-Zhen Huang at
  • Email: hsz1959@163.com
  • Institution:Institute of Botany, Jiangsu Province and Chinese Academy of Science, Nanjing 210014, China

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Gu C-S, Liu L-Q, Deng Y-M, et al. (2014) Validation of reference genes for RT-qPCR normalization in Iris. lactea var. chinensis leaves under different experimental conditions. Scientia Horticulturae 175, 144-149.
  2. Lv HH, Wang HL, He YF, et al. (2015) Separation and purification of four oligostilbenes from Iris lactea Pall. var. chinensis (Fisch.) Koidz by high-speed counter-current chromatography. Journal of Chromatography B-Analytical Technologies in the Biomedical and Life Sciences 988, 127-134

Categories