Ixodes scapularis

From ICG
Jump to: navigation, search

Description

Ixodes scapularis.png
  • Ixodes scapularis are highly efficient arthropod vectors of infectious diseases, being able to transmit viruses, bacteria, protozoa, and helminth parasites. It is a vector for human diseases like Lyme borreliosis, human granulocytic anaplasmosis, and babesiosis in the Central and Eastern United States. It belongs to the subarctic Ixodes persulcatus complex of species that include Ixodes ricinus and Ixodes pacificus, vectors of Lyme disease in Asia, Europe and the western US, respectively[1][2].
  • Common Name: Deer tick, Blacklegged tick
  • NCBI Taxonomy

Different Feeding Phases

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rps4[1] Ribosomal protein S4
  • Salivary glands and synganglia
DQ066214
  • F:GGTGAAGAAGATTGTCAAGCAGAG
  • R:TGAAGCCAGCAGGGTAGTTTG
80 55 SYBR
l13a[1] Ribosomal protein L13A
  • Salivary glands and synganglia
XM_002436237
  • F:GCATTTCGGGCAGTTTCTTCAG
  • R:TACTTTCGCCTGGGGTTGA
280 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: YOONSEONG PARK
  • Email: ypark@ksu.edu
  • Institution: Department of Entomology, Kansas State University, 123 Waters Hall, Manhattan, KS 66506

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.
  2. Kaufman W R. Tick-host interaction: a synthesis of current concepts[J]. Parasitology today, 1989, 5(2): 47-56.

Categories