Jatropha curcas

From ICG
Jump to: navigation, search

Description

Jatropha curcas.png
  • Jatropha curcas is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization [1] [2].
  • Common Name: Physic nut
  • NCBI Taxonomy

Staminate & Pistillate Flowers

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUB[1] Tubulin beta-5 chain
  • Staminate flower
XM_012218098.1
  • F:TTCTGGAATGGGAACTCTGTTGA
  • R:TTGATGTACAGAAAGGGTGGCAT
142 59 ~ 61 SYBR
EF[1] Elongation factor 1-alpha
  • Staminate flower
  • Pistillate flowers
XM_012226913.1
  • F:GTCTGTTGAGATGCACCATGAAG
  • R:TAGAGGCAACAAAACCACGTTTC
108 59 ~ 61 SYBR
GAPDH1[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Pistillate flowers
XM_012231954.1
  • F:TCTGCTGATGCACCAATGTTTG
  • R:ACCTTAGCAAGAGGAGCAAGAC
116 59 ~ 61 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fang Chen
  • Email: fangchenscu@163.com
  • Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

Different tissues & Developmental stages & Abiotic stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
actin [3] Actin
  • Different developmental stages
  • Various abiotic stress treatments
  • Vegetative stage
  • Cold stress
Jcr4S06558.10
  • F:5'-CTCCTCTCAACCCCAAAGCCAA-3'
  • R:5'-CACCAGAATCCAGCACGATACCA-3'
147 65 SYBR
GAPDH [3] Glyceraldehyde-3-phosphate dehydrogenase
  • Different developmental stages
  • Abiotic stress treatments
  • Reproductive stage
  • Cold stress
Jcr4U29393.10
  • F:5'-TGAAGGACTGGAGAGGTGGAAGAGC-3'
  • R:5'-ATCAACAGTTGGAACACGGAAAGCC-3'
140 65 SYBR
EF1α [3] Eukaryotic translation elongation factor 1 alpha 1
  • Different developmental stages
  • Reproductive stage
Jcr4S00542.10
  • F:5'-AAGATGATTCCCACCAAGCCCA-3'
  • R:5'-CACAGCAAAACGACCCAGAGGA-3'
72 65 SYBR
TUB5 [3] Tubulin beta-5 chain
  • Desiccation stress
GW878948.1
  • F:5'-TATGTTCCCAGGGCGGTTCTAATG-3'
  • R:5'-GGACTGCCCAAAGACAAAGTTATCG-3'
111 65 SYBR
TUB8 [3] Tubulin beta 8
  • Vegetative stage
  • Desiccation stress
GW877086.1
  • F:5'-GCAGGGAATAACTGGGCTAAAGGT-3'
  • R:5'-CTCCACCCAACGAATGACAAACTT-3'
136 65 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeng-Fu Xu
  • Email: zfxu@xtbg.ac.cn
  • Institution: Key Laboratory of Tropica l Plant Resource and Sustainable Use, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Menglun 666303, Yunnan, China

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-10-15])

References

  1. 1.0 1.1 1.2 1.3 Karuppaiya P, Yan XX, Liao W, et al. (2017) Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant. PLoS One 12, e0172460
  2. Peng X, Wang Q, Liu H, Shen S (2017) Phylogenetic and functional analysis of the basic transcription factor gene BTF3 from Jatropha curcas. Plant Growth Regulation 82, 247-257
  3. 3.0 3.1 3.2 3.3 3.4 Zhang L, He LL, Fu QT, Xu ZF. Selection of reliable reference genes for gene expression studies in the biofuel plant Jatropha curcas using real-time quantitative PCR. Int J Mol Sci. 2013 Dec 13;14(12):24338-54. doi: 10.3390/ijms141224338

Categories