Actinidia chinensis

From ICG
(Redirected from Kiwifruits)
Jump to navigation Jump to search

Description

Actinidia chinensis.png
  • Actinidia chinensis is a dioecious species in which size of fruits is strongly dependent on pollination. Two major factors limite the efficiency of pollination in this species, the short effective pollination period (EPP) of the female cultivar and the lack of flowering coincidence between the female cultivar and the male pollen donor. It is currently accepted that the consumption of kiwifruit has a preventive effect against certain cancers and cardiovascular disease. Many different cancers, especially cancers of the digestive system, lung, and liver, have been treated with kiwifruit prescriptions due to its cytotoxic and antioxidant activities [1][2].
  • Common Name: Kiwifruit
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S (P2)[1] 18S ribosomal RNA
  • Mature leaves, fruit flesh, axillary buds and stigmatic arms
AF419792
  • F:CTGTGAAACTGCGAATGGCTC
  • R:TTCCAGAAGTCGGGGTTTGT
110 56.6 SYBR
ACT (P2)[1] Actin
  • Mature leaves, fruit flesh and stigmatic arms
EF063572
  • F:GCAGGAATCCATGAGACTACC
  • R:GTCTGCGATACCAGGGAACAT
120 58 SYBR
ACT (P3)[1] Actin
  • Axillary buds
EF063572
  • F:TGCATGAGCGATCAAGTTTCAAG
  • R:TGTCCCATGTCTGGTTGATGACT
115 57.05 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: MV González
  • Email: mvictoria.gonzalez@usc.es
  • Institution: Departamento de Fisiología Vegetal, Facultad de Farmacia, Universidad de Santiago, Campus Sur, 15872, Santiago de Compostela, Spain

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Ferradás Y, Rey L, Martínez Ó, Rey M, González MV (2016) Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit. Plant Physiology and Biochemistry 102, 27-36.
  2. Du GR, Li MJ, Ma FW, Liang D (2009) Antioxidant capacity and the relationship with polyphenol and Vitamin C in Actinidia fruits. Food Chemistry 113, 557-562.

Categories