Leptinotarsa decemlineata

From ICG
Jump to: navigation, search

Description

Leptinotarsa decemlineata.png
  • Leptinotarsa decemlineata (Colorado potato beetle) is an exotic invasive insect pest. It invaded in Xinjiang Uygur autonomous region in China in the 1990s from Kazakhstan. It is a notorious defoliator of potato throughout most of the northern Xinjiang, and often causes extremely large yield losses of potato. It has a complicated and diverse life cycle and has developed resistance to many classes of insecticides.
  • Common Name: Say, Colorado potato beetle
  • NCBI Taxonomy

Different Developmental Stages & Insecticide Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RP18[1] Ribosomal protein 18
  • Different developing stages
  • Midgut, fat body and cuticle
  • Insecticide treatments
KC190034
  • F:ACTTCGTGTCACTGAAACTGC
  • R:TATCCGCACGACTTCCTGC
252 60 SYBR
RP4[1] Ribosomal protein 4
  • Different developing stages
  • Midgut, fat body and cuticle
  • Insecticide treatments
KC190033
  • F:GCACCAGGTCTTGTTCGTG
  • R:GGGGAATACGGGCGACAG
311 60 SYBR
ARF1[1] ADP-ribosylation factor 1
  • Different developing stages
  • Midgut, fat body and cuticle
  • Insecticide treatments
KC190026
  • F:GGGGAGGCAAACCGGTCA
  • R:GGCTTCTAAACCTAGTGCCTGG
603 60 SYBR
ARF4[1] ADP-ribosylation factor 4
  • Different developing stages
  • Midgut, fat body and cuticle
  • Insecticide treatments
KC190027
  • F:GGACCTATCTTCAGCTATGCGT
  • R:CAATCCCTCGTGAAGGCCA
681 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guo-Qing Li
  • Email: : liguoqing001234@yahoo.com.cn
  • Institution: Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 60 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Xiao-Qin Shi, Wen-Chao Guo, Pin-Jun Wan, Li-Tao Zhou, Xiang-Liang Ren, Tursun Ahmat, Kai-Yun Fu, and Guo-Qing Li. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res Notes. 2013; 6: 93. BMC Res Notes. 2013; 6: 93. Published online 2013 Mar 13. doi: 10.1186/1756-0500-6-93. PMCID: PMC3600673.

Categories