Leptospira interrogans

From ICG
Jump to: navigation, search

Description

Leptospira interrogans.png
  • Leptospira interrogans are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions. Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. As the severe manifestation of disease, it has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%[1][2].
  • Common Name: NA
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A2[1] Eukaryotic translation elongation factor 1 alpha 2
  • Skeletal muscle tissue
  • Temperature Treatment
NA
  • F:GCAGCCATTGTGGAGATG
  • R:ACTTGCCCGCCTTCTGTG
196 60 SYBR
HMBS[1] Hydroxymethylbilane synthase
  • Skeletal muscle tissue
  • Temperature Treatment
NA
  • F:CTTTGGAGAGGAATGAAGTGG
  • R:AATGGTGAAGCCAGGAGGAA
81 60 SYBR
SF3A1[1] Splicing factor 3 subunit 1
  • Skeletal muscle tissue
  • Temperature Treatment
NA
  • F:GCGGGAGGAAGAAGTAGGAG
  • R:TCAGCAAGAGGGACACAAA
106 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A. de la Peña-Moctezuma
  • Email: delapema@servidor.unam.mx
  • Institution: Departamento de Microbiologı́a e Inmunologı́a, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México, Coyoacán 04510, México.

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Carrillo-Casas EM, Hernández-Castro R, Suárez-Güemes F, de la Peña-Moctezuma A. Selection of the internal control gene for real-time quantitative rt-PCR assays in temperature treated Leptospira. Curr Microbiol. 2008 Jun;56(6):539-46. doi: 10.1007/s00284-008-9096-x. Epub 2008 Mar 18. PubMed PMID: 18347854.
  2. Eshghi A, Pappalardo E, Hester S, Thomas B, Pretre G, Picardeau M. Pathogenic Leptospira interrogans exoproteins are primarily involved in heterotrophic processes. Infect Immun. 2015 Aug;83(8):3061-73. doi: 10.1128/IAI.00427-15. Epub 2015 May 18. PubMed PMID: 25987703; PubMed Central PMCID: PMC4496612.

Categories