Lilium davidii

From ICG
Jump to: navigation, search

Description

Lilium davidii var. davidii.png
  • Lilium davidii var. unicolor, which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses[1][2].

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Different organs
  • Leaves, scales and roots under stress treatments
  • Leaves and scales at different developmental stages
KP861871
  • F:ATCTATGAGGGTTATGCTCTTCC
  • R:CATCAGGCAGCTCGTAACTTC
241 60 SYBR
GAPDH[1] Glyceraldehyde-3- phosphate dehydrogenase
  • Different organs
  • Leaves and scales at different developmental stages
KP179417
  • F:GCTGCAAGTTTCAACATTATTCC
  • R:ATCCTCATCAGTATAACCAAGA
240 60 SYBR
UBQ[1] Ubiquitin
  • Different organs
KP861873
  • F:TATGGTGGATTATCGGTTTCTACTG
  • R:ACCACAGACTTTTTCAGTATCGCA
293 60 SYBR
AP4[1] AP-4 complex subunit
  • Different organs
  • Leaves, scales and roots under stress treatments
  • Leaves and scales at different developmental stages
KP861878
  • F:GATGGGGCTTCTTTATACGGT
  • R:TCATTACAGCAAACTCTCCCTCT
163 60 SYBR
FP[1] F-box family protein
  • Leaves, scales and roots under stress treatments
KP861876
  • F:TCGCCTACATCGCTAACC
  • R:TTCCCAATAATCGCAAGACC
169 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: HongMei Sun
  • Email: hmbh@sina.com
  • Institution: Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Li X, Cheng J, Zhang J, et al. (2015) Validation of Reference Genes for Accurate Normalization of Gene Expression in Lilium davidii var. unicolor for Real Time Quantitative PCR. PLoS One 10, e0141323.
  2. Li XY, Wang CX, Cheng JY, et al. (2014) Transcriptome analysis of carbohydrate metabolism during bulblet formation and development in Lilium davidii var. unicolor. Bmc Plant Biology 14.

Categories