Lilium regale

From ICG
Jump to: navigation, search

Description

Lilium regale.png
  • Lilium regale is one of the most important floricultural crops with great ornamental value in the world. Thousands of cultivars in this genus were produced under inter-specific hybridization and artificial selection in the last twenty years. It is a vigorous bulbous perennial to 2m in height, with narrow glossy green leaves and racemes of fragrant, trumpet-shaped white flowers, yellow in the centre and flushed with purple on the outside. There was a positive correlation between volatile emissions and floral scent intensities. The scented and light-scented Lilium species emitted greater amounts of volatiles at night. [1] [2].
  • Common Name: Regal lily
  • NCBI Taxonomy

Different Developmental Stages & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
BHLH[1] Basic helix-loop-helix
  • Different developmental stages & stress
KJ543467
  • F:CCAGCAGGTTGTCCTTGTG
  • R:TCCGTGATGAGAAGCAGAGG
142 56 SYBR
SAND[1] SAND family protein
  • Under biotic stress
  • Under cold stress
KJ543463
  • F:CCAATACCCAGATGAGGAGACAAA
  • R:GGATTCGCATTGAGGCTGTTC
178 54 SYBR
CYP[1] Cycolphilin A
  • Under drought stress
  • Heat stress
KJ543464
  • F:ACCCTTGGGCAAGAACAACAGAA
  • R:GCAAAGGAGGTTGAGTTGGAGGAT
127 56 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Different developmental stages & stress
  • Under drought stress
  • Under cold stress
KJ543468
  • F:CACGGTCAGTGGAAGCACCATGAGAT
  • R:AGCAGCAGCCTTATCCTTGTCAGTGA
180 60 SYBR
TIP41[1] TIP41 family protein
  • Salinity stress
KJ543466
  • F:CGAAGCCAGAAACGGAGAAGAAT
  • R:GGGTAGGGTGGATTGGGAAGA
192 55 SYBR
EF1[1] Elongation factor 1-a
  • Various developmental stages
KJ543461
  • F:GGCACTAACTCGCTCCTTCTG
  • R:TTGGTAAGATGCTGGTGATTGGAT
173 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Gui-Xia Jia
  • Email: gxjia@bjfu.edu.cn
  • Institution: Beijing Key Laboratory of Ornamental Plants Germplasm Innovation & Molecular Breeding, National Engineering Research Center for Floriculture, Beijing Laboratory of Urban and Rural Ecological Environment and College of Landscape Architecture, Beijing Forestry University, Beijing, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Liu Q, Wei C, Zhang MF, Jia GX (2016) Evaluation of putative reference genes for quantitative real-time PCR normalization in Lilium regale during development and under stress. PeerJ 4, e1837
  2. Kong Y, Bai JR, Lang LX, et al. (2017) Floral scents produced by Lilium and Cardiocrinum species native to China. Biochemical Systematics and Ecology 70, 222-229.

Categories