Ganoderma lucidum

Description

Ganoderma lucidum, a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium ^[1]^[2].
Common Name: Ling zhi
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
PP2A^[1]	protein phosphatase 2A	Different fermentation conditions	GL15755	F:CACGCTTATCATATCCACTCCA R:GGCTTGATGTCCACGATGTT	131	60	SYBR
RPL4^[1]	ribosomal protein L4	Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies	GL25990	F:GTCAACAAGGGCGTTCTCTT R:ACAGCGTCTTGAGGAAGGT	151	60	SYBR
BTU^[1]	β-tubulin	Different fermentation conditions Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies	GL27826	F:CAGTTCACGGCGATGTTCA R:CGACGGTAGCATCCTGGTA	142	60	SYBR

Name: Jiang Xu
Email: xj8442cn@gmail.com
Institution: The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China

Cited by 10 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Xu J, Xu Z, Zhu Y, Luo H, Qian J, Ji A, Hu Y, Sun W, Wang B, Song J, Sun C, Chen S. Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum. Curr Microbiol. 2014 Jan;68(1):120-6. doi: 10.1007/s00284-013-0442-2. Epub 2013 Sep 8. PubMed PMID: 24013612.
↑ Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S. Genome-wide analysis of simple sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene. 2013 Jan 10;512(2):331-6. doi: 10.1016/j.gene.2012.09.127. Epub 2012 Oct 13. PubMed PMID: 23069850.