Lolium multiflorum

From ICG
Jump to: navigation, search

Description

Lolium multiflorum.png
  • Lolium multiflorum is a cool-season annual grass cultivated worldwide for its high yield and quality. It is cultivated in temperate and subtropical regions worldwide and used in the forage and livestock system as silage and green fodder for its high palatability and digestibility. As a promising species with high biomass and wide geographic distribution, ryegrass can be easily cultivated for phytoremediation and bio-ethanol production, and accumulate heavy metals in root and shoot, including Cu, Zn and Cd[1] [2].
  • Common Name: Italian rye-grass, Annual ryegrass
  • NCBI Taxonomy

Salt Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
eEF1A[1] Elongation factor 1-α-like protein
  • Leaves with salinity treatment
EZ421973
  • F:GATGATTCCCACCAAGC
  • R:TAGTAGCAGACAACCACCAG
200 56 SYBR
TBP-1[1] 26S protease regulatory subunit-like protein
  • Universal reference gene with salinity treatment
EZ421974
  • F:CGAGATGCCTTTGAG
  • R:GCGGCAATCACCTTTA
188 56 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xinquan Zhang
  • Email: zhangxq@sicau.edu.cn
  • Institution: Grassland Science Department, Sichuan Agriculture University, Chengdu 611130, China

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Wang X, Ma X, Huang L, Zhang X (2015) Identification of the valid reference genes for quantitative RT-PCR in annual ryegrass (Lolium multiflorum) under salt stress. Molecules 20, 4833-4847.
  2. Fang Z, Hu Z, Zhao H, et al. (2017) Screening for cadmium tolerance of 21 cultivars from Italian ryegrass (Lolium multiflorum Lam) during germination. Grassland Science 63, 36-45.

Categories