Lolium perenne

From ICG
Jump to: navigation, search

Description

Lolium perenne-1.jpg
  • Lolium perenne (Perennial ryegrass) is dominant forage and turf grass specie in temperate regions due to its good grazing tolerance, extraordinarily high digestibility and adequate seed production. Perennial ryegrass is cultivated in the USA, China, Japan, UK, Australia, New Zealand, South Africa and South America. The species may also aid China in mitigating food shortages issue since it may be capable of producing marketable yields on marginal agricultural land [1][2].
  • Common Name: perennial ryegrass
  • NCBI Taxonomy

Various Abiotic Stress Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
eIF4A[1] Eukaryotic initiation factor 4 alpha
  • Drought stress
  • Salt stress
  • Heat stress
  • ABA
  • Waterlogging treatments
GO924770
  • F:AACTCAACTTGAAGTGTTGGAGTG
  • R:AGATCTGGTCCTGGAAAGAATATG
168 60 SYBR
TEF1[1] Transcription elongation factor 1
  • Drought stress
  • Salt stress
  • ABA
  • Waterlogging treatments
GR522099
  • F:CGTGTGATCGAGAGGTTTGA
  • R:CGAATTTCCAGAGGGCAATA
133 60 SYBR
TBP-1[1] Tat binding protein-1
  • Drought stress
  • Salt stress
  • Heat stress
GO924783
  • F:TGCTTAGTTCCCCTAAGATAGTGA
  • R:CTGAGACCAAACACGATTTCA
112 60 SYBR
E2[1] Ubiquitin-conjugating enzyme
  • Heat stress
  • ABA
GO924794
  • F:CGGTTCTGTGCCAAAATGT
  • R:CAGCTATCTCCAACGGTTCA
111 60 SYBR
UBQ[1] Ubiquitin
  • Waterlogging treatments
GR510338
  • F:AAAATTCCCCAATCAATCTCCT
  • R:CTTCACAAAGATCTGCATCTTGA
89 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xinquan Zhang
  • Email: zhangxq@sicau.edu.cn
  • Institution: Department of Grassland Science, Animal Science and Technology College, Sichuan Agricultural University, Ya’an, Sichuan, China

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Huang L, Yan H, Jiang X, Yin G, Zhang X, Qi X, Zhang Y, Yan Y, Ma X, Peng Y. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoS One. 2014 Apr 3;9(4):e93724. doi: 10.1371/journal.pone.0093724. eCollection 2014. PubMed PMID: 24699822; PubMed Central PMCID: PMC3974806.
  2. Wilkins PW, Humphreys MO (2003) Progress in breeding perennial forage grasses for temperate agriculture. J Agric Sci 140: 129–150.

Categories