Lolium spp

From ICG
Jump to: navigation, search

Description

Lolium temulentum.png
  • Lolium spp, perennial ryegrass, the most important pasture-grass species for temperate zones, it is cultivated for dairy, meat, and wool production and is also an important turf- and amenity-grass species. Perennial ryegrass is a member of family Poaceae and is related to more extensively studied grass species, such as the cereals wheat, barley, maize, and rice[1][2].
  • Common Name: Darnel, Poison darnel
  • NCBI Taxonomy

Resistant to Acetolactate-Synthase Inhibitors

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CAP[1] Cap-binding protein
  • Herbicide response in other weed species
EU328530
  • F:CTCCAGGGAAGATGCTGAAG
  • R:CTTGAAAGCCCCAATCAAAA
95 57 StepOnePlus
GAPDH[1] Glyceraldehyde-3-phosphate-dehydrogenase
  • Herbicide response in other weed species
EU328533
  • F:AGGTTATCAATGACAAGTTTGG
  • R:ATCAACAGTCTTCTGGGTAGC
83 60 StepOnePlus
UBQ[1] Ubiquitin
  • Herbicide response in other weed species
EF470423
  • F:CAAGAAGAAGACGTACACCAAG
  • R:GACCTTGTAGAACTGGAGGAG
85 57 StepOnePlus

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Christophe Délye
  • Email: delye@dijon.inra.fr
  • Institution:INRA, UMR1347 Agroécologie, Dijon, France

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Duhoux A, Délye C. Reference genes to study herbicide stress response in Lolium sp.: up-regulation of P450 genes in plants resistant to acetolactate-synthase inhibitors[J]. PloS one, 2013, 8(5): e63576.
  2. Holmes, W. 1980. Grass: its production and utilisation. Blackwell Scientific Publications, Oxford.

Categories