Lucilia cuprina

From ICG
Jump to: navigation, search

Description

Lucilia cuprina.png
  • Lucilia cuprina,is an important pest of sheep in Australia and other parts of the world. It is a member of the order Diptera, has a pair of short but very strong membranous wings and a pair of hindwings reduced and modified to clublike balancers known as halteres. It is of significant concern as a result of the welfare issues and production losses that arise when gravid female blow flies deposit eggs on sheep, giving rise to fly strike. It is an important ecto-parasite that causes fly strike, which has significant health and welfare, as well as economic, impacts on the sheep industry in Australia[1] [2].
  • Common Name: Australian sheep blowfly
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S rRNA[1] 18S rRNA
  • Eggs, L1, L3, pupae and adult life stages
AF322425
  • F:AGCAGTTTGGGGGCATTAG
  • R:AGCAGTTTGGGGGCATTAG
NA NA SYBR
28S rRNA[1] 28S rRNA
  • Eggs, L1, L3, pupae and adult life stages
EU626548
  • F:CCAAAGAGTCGTGTTGCTTG
  • R:ATTCAGGTTCATCGGGCTTA
NA NA SYBR
GST1[1] Glutathione S-transferase
  • Eggs, L1, L3, pupae and adult life stages
L23126
  • F:GCCAGTGTCAGCACCTTTG
  • R:GCAACCTTCCCAGTTTTCATC
NA NA SYBR
β-tubulin[1] β-tubulin
  • Eggs, L1, L3, pupae and adult life stages
GQ284558
  • F:AAGCTGACGACACCCACATAC
  • R:CGGGCATGAAGAAGTGAAGA
NA NA SYBR
RPLPO[1] Acidic ribosomal phosphoprotein PO
  • Eggs, L1, L3, pupae and adult life stages
GQ284556
  • F:ACCCATAAGGACGACACC
  • R:GGTGCTGACAATGTTGGTTC
NA NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A.C.KOTZE
  • Email: andrew.kotze@csiro.au
  • Institution: CSIRO (Commonwealth Scientific & Industrial Research Organization) Livestock Industries, St. Lucia, Brisbane, Queensland, Australia

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Bagnall N H, Kotze A C. Evaluation of reference genes for real‐time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina[J]. Medical and veterinary entomology, 2010, 24(2): 176-181.
  2. Bagnall NH, Hines BM, Lucke AJ, Gupta PK, Reid RC, Fairlie DP, Kotze AC.Int J Parasitol Drugs Drug Resist. 2017 Apr;7(1):51-60. doi: 10.1016/j.ijpddr.2017.01.001. Epub 2017 Jan 10.PMID: 28110187 Free PMC Article.

Categories