Lucilia sericata

From ICG
Jump to: navigation, search

Description

Lucilia sericata.png
  • Lucilia sericata is a blow fly found in most areas of the world, and the most well-known of the numerous green bottle fly species. It is the only species currently approved for maggot debridement therapy (MDT), an alternative treatment for chronic and recalcitrant wounds. Larvae of the blowfly facilitate wound healing by removing dead tissue and biofilms from non-healing and necrotic wounds. Another beneficial action of larvae and their excretions/secretions (ES) is down-regulation of excessive inflammation [1] [2].
  • Common Name: Common green bottle fly
  • NCBI Taxonomy

Immune Challenge

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1α[1] Elongation factor 1-alpha 1
  • Midgut, hindgut, salivary glands, crop and fat body
  • Boost the larval immune system
KR133396
  • F:TGTCGGTGTCAACAAGATGG
  • R:GAGATGGGAACGAAGGCAAC
137 60 SYBR
RPLP0[1] 60S acidic ribosomal protein P0
  • Midgut, hindgut, salivary glands, crop and fat body
  • Boost the larval immune system
KR133397
  • F:GGTGCTGATAATGTTGGTTC
  • R:ACCCATAAGGACGACACC
78 60 SYBR
RPS3[1] 40S ribosomal protein S3
  • Midgut, hindgut, salivary glands, crop and fat body
  • Boost the larval immune system
KR133395
  • F:TCAAGGTGTTTTGGGTATCAAGG
  • R:GCGGGCATTTTGTATTCTGTTTC
78 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zdeněk Franta
  • Email: zdenek.franta@ime.fraunhofer.de
  • Institution:Department of Bioresources, Fraunhofer Institute for Molecular Biology and Applied Ecology, Giessen,Germany

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Baumann A, Lehmann R, Beckert A, Vilcinskas A, Franta Z (2015) Selection and Evaluation of Tissue Specific Reference Genes in Lucilia sericata during an Immune Challenge. PLoS One 10, e0135093.
  2. Tamura T, Cazander G, Rooijakkers SHM, Trouw LA, Nibbering PH (2017) Excretions/secretions from medicinal larvae (Lucilia sericata) inhibit complement activation by two mechanisms. Wound Repair and Regeneration 25, 41-50.

Categories