Lycoris aurea

From ICG
Jump to: navigation, search

Description

Lycoris aurea-1.jpg
  • Lycoris aurea (L' Hér.) Herb, also called Golden Magic Lily, is an ornamentally and medicinally important species of the Amaryllidaceae family. It belonged to the genus Lycoris which composed of approximately 20 species of flowering plants native to the moist warm temperate woodlands of eastern and southern Asia. Like other species of genus Lycois, L. aurea is very durable, tolerating the extremes of drought and waterlogging, as well as poor soil conditions. It also accumulates Amaryllidaceae alkaloids such as lycorine and galanthamine, which have been reported to exhibit medical values. In general, Amaryllidaceae alkaloids are regarded as derivatives of the common precursor 4′-O-methylnorbelladine [1].
  • Common Name: Golden Magic Lily
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EXP1[1] Expressed protein 1
  • All samples
  • NaCl stress
  • Heat stress, polyethylene glycol (PEG) stress and ABA treatment
  • Various tissues
GBXB01024031
  • F:ATTGAAACAACCTACACCGCAA
  • R:GCTGTAAGAATGCTAATCGTTCA
133 60 SYBR
TIP41[1] TIP41-like protein
  • All samples
  • Methyl jasmonate(MeJA) treatment
    • Various tissues
HACC01023453
  • F:GCAACCATCCAAAGTTTAACTGCT
  • R:AATGTGCAAGCAGGGCTAGTAA
157 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme
  • NaCl stress
  • Cold stress
NA
  • F:TGCCTTGACCATCTCCAAGGTT
  • R:CTCAACTATCCATCCGCTCACCC
200 60 SYBR
PTBP1[1] Polypyrimidine tract-binding protein 1
  • Heat stress, polyethylene glycol (PEG) stress and ABA treatment
  • Sodium nitroprusside (SNP) treatment
HACC01018615
  • F:GCAATTTTTGAGAAGAATGGTG
  • R:GACAGATGAAGCTTACAGTAAC
131 60 SYBR
CYP2[1] Cyclophilin 2
  • Cold stress
GBXB01024543
  • F:TCCCGATTCTTCTGGAAAGG
  • R:AAGCCTTGTCTGGTAGAACAGC
181 60 SYBR
PP2A[1] Serine/threonine-protein phosphatase 2A
  • Sodium nitroprusside (SNP) treatment
NA
  • F:GTACCGAACATTAAATTCAAT
  • R:CTTGATTTGCAAAATATCTGAC
176 60 SYBR
CYP1[1] Cyclophilin 1
  • Methyl jasmonate(MeJA) treatment
HACC01018398
  • F:TCGTGAGGGCCATCGAGAAGGT
  • R:CTCATAACAAACAGACCATTATT
137 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ren Wang
  • Email: jswangren@aliyun.com
  • Institution: Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing, China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Ma R, Xu S, Zhao Y, Xia B, Wang R. Selection and Validation of Appropriate Reference Genes for Quantitative Real-Time PCR Analysis of Gene Expression in Lycoris aurea. Front Plant Sci. 2016 Apr 25;7:536. doi: 10.3389/fpls.2016.00536. eCollection 2016. PubMed PMID: 27200013; PubMed Central PMCID: PMC4843812.

Categories