Macaca fascicularis

From ICG
Jump to: navigation, search

Description

Macaca fascicularis.png
  • Macaca fascicularis is one of the most commonly used nonhuman primate animal models for studying various diseases, such as inflammation, atherogenesis, chronic wasting disease (CWD), amyotrophic lateral sclerosis (ALS), Parkinson’s disease, Alzheimer’s disease, and chikungunya disease because of its biological and behavioral similarities to, and close genetic relationship with, humans[1][2].
  • Common Name: Crab-eating macaque
  • NCBI Taxonomy

Different Whole-body Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARFGAP2[1] ADP-ribosylation factor GTPase activating protein 2
  • Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
NA
  • F:GCGTCCATCTGAGCTTCATC
  • R:CATCATTGGCTGTGCATCCA
135 60 SYBR
MRFAP1[1] Morf4 family associated protein 1
  • Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
NA
  • F:GCGGATAGAGAAGAGCGAGT
  • R:AGCCAATCTCCACCAGTTGA
82 60 SYBR
ARL1[1] ADP-ribosylation factor-like 1
  • Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
NA
  • F:AGACAGTTGTGACCGAGACC
  • R:TGAGGAAGTCATGGCCTGTT
136 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Heui-Soo Kim
  • Email: khs307@pusan.ac.kr
  • Institution: National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Chungbuk, Republic of Korea

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Park S J, Kim Y H, Huh J W, et al. Selection of new appropriate reference genes for RT-qPCR analysis via transcriptome sequencing of cynomolgus monkeys (Macaca fascicularis)[J]. PLoS One, 2013, 8(4): e60758.
  2. De Pablos V, Barcia C, Martinez S, Gomez A, Ros-Bernal F, et al. (2009) MPTP administration increases plasma levels of acute phase proteins in non-human primates (Macaca fascicularis). Neurosci Lett 463: 37–39.

Categories