Macrobrachium olfersii

From ICG
Jump to: navigation, search

Description

Macrobrachium olfersii.png
  • Macrobrachium olfersii has wide distribution in the Americas and is emerging as a potential model for development, developmental toxicity and environmental toxicology studies. It exhibits physiological characteristics typical of a recent freshwater invader, but is still dependent on brackish water for larval development and metamorphosis. Its embryonic development has been well-characterized both morphologically and chronologically. However, the molecular mechanisms of development, particularly in the embryonic stages, remained unknown. [1] [2]
  • Common Name: Giant freshwater prawn,Shrimp
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RpL8[1] Ribosomal protein L8 (RpL8)
  • Embryonic development
KY027065
  • F:GTATTGTTGCTGGTGGAGGTC
  • R:CTCTACAGGGTTCATCGCTAC
125 60 GoTaq
RpS6[1] Ribosomal protein S6 (RpS6)
  • Embryonic development
KY027064
  • F:CTGTCTGTACTTGCCCTGATG
  • R:GCGTGGAATGCTGTTGTCTG
78 60 GoTaq

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Evelise M. Nazari
  • Email: evelise.nazari@ufsc.br
  • Institution: Universidade Federal de Santa Catarina, Departamento de Biologia Celular, Embriologia e Genética, 88040-900 Florianópolis, Santa Catarina, Brazil

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Jaramillo ML, Ammar D, Quispe RL, Guzman F, Margis R, Nazari EM, Müller YM. Identification and evaluation of reference genes for expression studies by RT-qPCR during embryonic development of the emerging model organism, Macrobrachium olfersii. Gene. 2017 Jan 20;598:97-106. doi: 10.1016/j.gene.2016.11.001. Epub 2016 Nov 5. PubMed PMID: 27825774.
  2. Mendonça NN, Masui DC, McNamara JC, Leone FA, Furriel RP. Long-term exposure of the freshwater shrimp Macrobrachium olfersii to elevated salinity: effects on gill (Na+,K+)-ATPase alpha-subunit expression and K+-phosphatase activity. Comp Biochem Physiol A Mol Integr Physiol. 2007 Apr;146(4):534-43. Epub 2006 Mar 10. PubMed PMID: 16529963.

Categories