Manihot esculenta

From ICG
Jump to: navigation, search

Description

Manihot esculenta-1.jpg
  • Cassava (Manihot esculenta Crantz) is a staple food crop in Africa, Latin America and Asia. It is a crop thriving in tropical and subtropical regions because of its starchy tuberous root, which is edible and a major source of carbohydrates. Native to the New World tropics and a member of family Euphorbiaceae, cassava and some 90 other species make up the genus Manihot. Cassava is the only widely cultivated member, being valued for its starchy tuberous roots, which provides food or an export com- modity in nearly all tropical countries of the world [1][2].
  • Common Name: Cassava
  • NCBI Taxonomy

Different Tissues & Developmental Stages & Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
NPC-β[2] Nascent polypeptide-associated complex subunit beta
  • Major cassava samples
cassava4.1_017977
  • F:ATGGGTTGTTAGCGGCTCT
  • R:ATCTGCTCCGCCAACTTCT
114 NA SYBR
HD[2] Histidinol dehydrogenase
  • Major cassava samples
  • Normally grown samples
cassava4.1_006391
  • F:ATTATGCAAGCGGGACAAAC
  • R:ACTCCACCGTACATCCTTGC
64 NA SYBR
RPL[2] Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein
  • Drought stressed samples
cassava4.1_014335
  • F:GTTTGATGAGCACCGGAAG
  • R:TCTTGGCCTGAGACTTGGA
62 NA SYBR
26S[2] 26S proteasome regulatory complex, subunit N10
  • Drought stressed samples
cassava4.1_006884
  • F:AATGCGCTCCTACAACAAGC
  • R:GATCATCCGTAGCAGCCTCT
100 NA SYBR
PP2A[2] Serine/threonine-PP2A catalytic subunit
  • Normally grown samples
cassava4.1_012496
  • F:GCTTGTCATGGAAGGGTACAA
  • R:TTCCCACATCGGTAGCAATAG
86 NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Wenquan Wang
  • Email: wangwenquan@itbb.org.cn
  • Institution: College of Agriculture, Hainan University, Haikou, China

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-09-01])

References

  1. Fregene M, Angel F, Gómez R, et al. A molecular genetic map of cassava (Manihot esculenta Crantz)[J]. TAG Theoretical and Applied Genetics, 1997, 95(3): 431-441.
  2. 2.0 2.1 2.2 2.3 2.4 2.5 Hu, Meizhen, et al. Validation of reference genes for relative quantitative gene expression studies in cassava (Manihot esculenta Crantz) by using quantitative real-time PCR. Frontiers in plant science 7 (2016).

Categories