Ruditapes philippinarum

Description

Ruditapes philippinarum, native to Japan, Korea, and the Philippines, was introduced accidentally, along with Pacific oysters, into North America during the 1930's. Currently, the Manila clam is distributed widely on Pacific coasts of Canada and the USA, Mediterranean and Atlantic coasts of Western Europe, Korean and Japanese waters, as well as on the East coast of China. For aquaculture purposes, it was then deliberately introduced as hatchery brood stock into France in 1972 and into the UK and Ireland in 1980 and 1982, respectively ^[1] ^[2].
Common Name: Manila clam
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF1A^[1]	Elongation factor 1 alpha	Hemocyte under CuO stress	JK845897	F:AAATGCACCACGAGTCCCTC R:CTTGCAGCTCCCTTTGGTGG	NA	60	SYBR
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Hemocyte under CuO stress	ruditapes_c8255	F:CCAGAAGGTTGTGGATGGGC R:GCGGCACCAGTAGATGATGG	NA	60	SYBR
TUBA^[1]	Tubulin alpha chain	Hemocyte under CuO stress	JK982951	F:AAGAGAGCCTTTGTCCACTGGT R:CCTCTCCCTCGCCTTCAACT	NA	60	SYBR
RPS20^[1]	40s Ribosomal Protein s20	Hemocyte under CuO stress	ruditapes_lrc33291	F:CGTAGGAAAGTCGCTGGCTC R:ATAGGGGCCTCATCAGTGGG	NA	60	SYBR

Name: Moritz Volland
Email: moritz.volland@icman.csic.es
Institution: Instituto de Ciencias Marinas de Andalucía (CSIC), Campus Universitario Río San Pedro s/n, 11510 Puerto Real, Cadiz, Spain

Cited by 1 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Volland M, Blasco J, Hampel M (2017) Validation of reference genes for RT-qPCR in marine bivalve ecotoxicology: Systematic review and case study using copper treated primary Ruditapes philippinarum hemocytes. Aquat Toxicol 185, 86-94.
↑ Donaghy L, Lambert C, Choi KS, Soudant P (2009) Hemocytes of the carpet shell clam (Ruditapes decussatus) and the Manila clam (Ruditapes philippinarum): Current knowledge and future prospects. Aquaculture 297, 10-24.