Medicago sativa

From ICG
Jump to: navigation, search

Description

Medicago sativa.png
  • Medicago sativa L. is a major forage legume grown extensively worldwide. This perennial species has a tetraploid (2n = 4x = 32) genome which displays tetrasomic inheritance and its populations are extremely polymorphic due to a high degree of outcrossing. Superior tolerance to environmental stress and decline in stem digestibility during plant development are major issues for its breeding programs. Insufficient tolerance to subfreezing temperatures reduces long term persistence of alfalfa in northern countries and is a source of major costs associated with stands reestablishment and the need to buy forage outside the farm[1] [2].
  • Common Name: Lucerne,Cultivated alfalfa
  • NCBI Taxonomy

Different Environmental & Developmental Regulation

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBL-2a[1] Ubiquitin protein ligase 2a
  • Cold Acclimation Indoors
  • Cold Acclimation Outdoor
  • Water Stress and Photoperiod
  • Plant Development
JZ818487
  • F:CCAAACCCAAACTCACCAG
  • R:AGCAGTCCAACTCTGCTCAAC
108 80.5 SYBR
ADF[1] Actin depolymerizing factor
  • Cold Acclimation Indoors
  • Cold Acclimation Outdoor
  • Water Stress and Photoperiod
  • Plant Development
JZ818469
  • F:GCATCTGGTATGGCAGTCC
  • R:GCACTCATCAGCAGGAAGG
183 81.4 SYBR
Rer1[1] Retention in endoplasmic reticulum 1 protein
  • Cold Acclimation Indoors
  • Cold Acclimation Outdoor
  • Water Stress and Photoperiod
  • Plant Development
JZ818481
  • F:GCCTTCTGATGGTGGACCT
  • R:GGCCAGAAGACAGGAACATC
165 78.9 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yves Castonguay
  • Email: yves.castonguay@agr.gc.ca
  • Institution: Soils and Crops Research and Development Center, Agriculture and Agri-Food Canada, Québec, Canada

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Castonguay Y, Michaud J, Dubé M-P (2015) Reference Genes for RT-qPCR Analysis of Environmentally and Developmentally Regulated Gene Expression in Alfalfa. American Journal of Plant Sciences 06, 132-143.
  2. Russelle, M.P. (2001) Alfalfa. American Scientist, 89, 252-261. http://dx.doi.org/10.1511/2001.3.252

Categories