Phyllostachys edulis

Description

Phyllostachys edulis is a large woody bamboo with the highest ecological, economic and cultural value of all bamboos in Asia, accounting for up to 70% of the total area of bamboo growth. Moso bamboo has been valued at US$5 billion of annual forest production in China, used as timber, paper and art ware, and the shoots as delicious food^[1]^[2] .
Common Name: Moso bamboo
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
TIP41^[1]	TIP41-like family protein	Root, stem, mature stem, leaf, flower, and leaf sheath Two developmental stages (before and after flowering)	FP092936	F:AAAATCATTGTAGGCCATTGTCG R:ACTAAATTAAGCCAGCGGGAGTG	102	60	SYBR
NTB^[1]	Nucleotide tract-binding protein	Root, stem, mature stem, leaf, flower, and leaf sheath Two developmental stages (before and after flowering)	FP091427	F:TCTTGTTTGACACCGAAGAGGAG R:AATAGCTGTCCCTGGAGGAGTTT	133	60	SYBR

Name: Mengzhu Lu
Email: lumz@caf.ac.cn
Institution: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Cited by 92 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 Fan C, Ma J, Guo Q, et al. Selection of reference genes for quantitative real-time PCR in bamboo (Phyllostachys edulis)[J]. PloS one, 2013, 8(2): e56573.
↑ Lobovikov M, Paudel S, Piazza M, Ren H, Wu J. World Bamboo Resources: A Thematic Study Prepared in the Framework of the Global Forest Resources Assessment (Food and Agriculture Organization of the United Nations, Rome, 2007); 2005.